--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (122592 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (37 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1283       1600   0    Initial    318    71        Good
cggaccaccacgtgcgtacaggggcagcgccgggggcgtggcgggggcgtggacgcccac
ccggaaccctagagcggcggcggcagcggcttccggccgcggcggacacttccctgggcg
ggactgtctcgtggcacccggtggaaccgaggagaacgtggagcgccgggagcggcgaat
ATGGACGACTACAGCCTGGATGAGTTCCGTCGGCGCTGGCAGGAGGAGCTGGCGCAGGCC
CAGGCGCCGAAGAAGCGGCGACGGCCCGAGGCTGCCGAGAGGCGGGCTCGGCGGCCGGAG
GTGGGCTCCGGGCGCGGCGAACAGGCCTCGGGGGACCCGGCGCTGGCCCAGCGTCTCCTG
GAGGGCGCGGGGAGGCCCCCGGCGGCGCGGGCGACTCGGGCCGAGGGGCAGGACGTAGCG
AGCCGCTCACGTTCTCCTCTGGCCCGCGAGGGCGCCGGGGGCGGGGAGCAGCTGGTGGAC
CAGCTCATCCGCGACCTG
gtgagtggccgtcgcctcccccccgcccatgcctgcgccggcccccgcccccaggacaaa
cccctgcagtgatttggagagtaactgtgtgccactagttgcccgagaaaatgagtagac
gcacaaacaccaatgtttgtgcttgcataggggtctttctggaagcagcacttcccaacc

Exon  2 +       5354       5399   2   Internal     46    57    Marginal
ataaagttataattcattgtgtgcgtaaactgtctccttggtactgtcttaagggtttag
agacattatcgtcttcatttctcccaacaactctctccagtggctattttcaactaatct
gtagatgagcattaggaaagtaactgatttttagataataaacctactccttctctccag
GCTGATAAATGATGACAAGGTTTATGGAAAAGGCTTGGATTCCTGT
gtcagtggttgcaagccccagagcccacagggctaaggcaggtaatgcacgtgagtgagg
taggctgggtgttgcacattaggtcttttctcccagctcatcaggtgtttttatgtgttc
tggtcatagctttataattcgtttcatagtggcagctgttctttttgtcacaattaaaca

Exon  3 +       8776       8976   0   Internal    201   100   Excellent
ggactctgggctgcaggcaacaagcacccaacccaaactggcttaaaaacccaaactgga
atctattgattcctgtaactgaaaattccaggtggtaatgtttgttctgggtgcttacct
aaggtaagtaggatttgccttctcttaatcctgctttccttttgttgactttattcacag
ACAGGCTTTCCTCTTGGGGAAAAATGGCTACCAGCAACTCTAGTCTTCTATCTGCTTAGC
AACTCAAGGGAAAGAGAGCTGCAAGTCATGAACCTAAATTCCCATTGCTGCAAACTGGGT
CATGTGTCCACCTTTCAGCCAATCACTGATTCAAATTGTTCAGACTCGAATCCATTGCCC
ATTCCTGAAGATGAAGGTGAG
gtcagctctgcctaaattgtgttgactaagagtgggagtgggatggtttcctaaatagag
gaagtggatgttgggcaggaaaaaagagcaataactgatatccattttaggtgggtgtgt
gacgcagcactaactgagaatacagtagtcccaccttatccactggagatacatttcaag

Exon  4 +      17478      17559   2   Terminal     82    57    Marginal
ttaaaaatggattttattaagcgagtgctgttgggacacagagtgaagcttttcctagct
ttgcagaagcacataccaaagtgagctttggcaggtggattgggaacaggcagaggggta
catacatacatacacttggctttttttctgtttcacactcatatttctttgtgctaccag
GATCGTCAATGACAGCCTTATCTCTCAAATAAAGCCCGTTACCTCATCTCTAATTGCTTA
TCCAAAGGCAGGCGAGCTCTGA
tttctctgcattaataaatgacaccgaagaagaactgctttgtttgcactggcccgctca
ggttaaccagtgtaagcccctgagagcattaggaaaccttgcacttctccagtggccaag
gagaggtggcgttcatctccatcaagagcagtgtctacttgtttactttttgctcatgtt

Exon  5 +      18268      18372   0   Internal    105   100   Excellent
agattctgaaatagttccatgactgcctggtgaaacagtatggatgcctccctcctggga
aacagcctcatctatcttgttaccacctaagaatatctctggtcatttaaagggcctgta
aatttgagttattttcatatctaaaaattataaacttctttcttttttttttcccctcag
AATGAAATGAATGATGTGCCTTTCTTTGATATCCAACTGCCTTACGAATTGGCAATCAAT
ATATTTCAGTATCTGGACAGGAAAGAACTAGGAAGATGTGCACAG
gtaaggtgtcaccaacagatgttccagattttcctaaatgtgtgattaaggtataggact
ctccggggtaatagaaatttactcacagaattataaactttgcagaattaatgaattgga
tggcaagtttacttgaaggaaagccaccttgaccttagaggattatgttccacatcacta

Exon  6 +      24701      24791   1   Internal     91    83        Good
tccttcctttcaatagttgtccctcgagggacttaatctctctgtgggagtgtttcttgc
cgaaacatcttgaaaacagtgtagcttttagtaagcaaagttacttgttggacagttcat
tgaacaggtttgtaatcttgctatttataattttatgttcatctttttttgtgcccacag
GATTCCTGGTATTTAAAGGAGACAATTTTTTAGTCGATAACAATGATACAGTTGTTGGTT
TCAAAATTACAAATTGGTTTTTAGGAGAAAA
gtaagtctgccattatattacagtgtgaataattctgaggagtgatggcttttaggtatt
taccaatattcattttttaaactttaaaaattattataaattcataggaagttgcaaaaa
atagtacagagagttcctgtgtacccttcccccagtttcctccattggtaatatcccgca

Exon  7 +      27624      27807   0    Initial    184    50    Marginal
gagcatgtgtgggtatgggggaagatcactcattggttgtgaggttgaggatgagctctt
cgttgagctctgggctgaagatggaaatttggaagctgtcagccacattgatggtattta
aggccaggagacaaatgagaacattaaggaagtgaatgtaaatagaggaggggttcaggg
ATGGAGCCCTGGTGCTCCACAAGGATTAGAGGCCGTGGACATGAGCAGGGCCAGGCAGAG
GACCGGGAAGGAGTTCCCTGCCAGGCAGGAAGAAAACCCAGATGTGTCGTTCCTTGGGAC
CATGGGATAAATGTTTTCCAGGAGGAGAAAGTGATCAAAGGTGTTAAGCGCTGTTGTTCA
TCAA
gtaagaggaggactgagaaatgaccattgggttttgcaagttggaggtcactggtgacct
tgaccagggtcagtggtgtgttgggggcaaaagctagtggctcaggagcaagtggagaga
gaggaaactgagacagtgagtgcatagagagctgtctctatgtggtgtgtcctcccacag

Exon  8 +      35609      35773   0   Internal    165   100   Excellent
gaaagataaaactggaaacatttgcttgtatttttttttccacctcatagtgttttgtta
atgagacattttatactgccataaacccagggcaataatataggtgttgattgatttttg
gatgacaaggggcttctctaattgcagaatttgacatttgtgtcacttctgctgttttag
GTGAGCAAGACGTGGAAGGTGATTGCAGAGGATGAGGTGCTGTGGTACAGGCTGTGCCAG
CAGGAAGGGCACCTTCCGGATAGCAGCATCTCTGACTATTCTTGCTGGAAGCTCATCTTC
CAAGAGTGCCGAGCCAAGGAACACATGTTACGAACCAACTGGAAG
gtgggcagtggccaatatcattacctgtgaaagaatagcctgcaaggacatgggaatcca
agctttcactcatagcctgagattaattgccaacagcgaagggagaggggtacactgagc
ctccccttcagctgttggtgacttgttgcccattttgttcaccattagatgatctgcctc

Exon  9 +      35997      36167   0   Internal    171    57    Marginal
aaggacatgggaatccaagctttcactcatagcctgagattaattgccaacagcgaaggg
agaggggtacactgagcctccccttcagctgttggtgacttgttgcccattttgttcacc
attagatgatctgcctctgttttcagcctcaagatttgggaacatcctcttattctgcag
GAGAGGAAGGGTGAGATTGGGTTGCCAGCCACTTCCTCTCGGATTGTTAGGGTGGTCAGA
GGAGTGCTCTGTGCAGCCCCTTTGACTTTCACCGACTCTCTGGAGGGACCCAGAAAGCAA
AAGCACTACCTGCATACAAAAGAGGAGCTGAAAATGTCATTTCTAGTAAAT
gtaagagggagatgattaaacatctctaagcactgtcttctcttccctcacataacctat
tggcgtgcttccataacatttatcacttcaaagtctctacggaaatattagatcacagct
aagaatttgcacagtgaagtgtttccataggagataactgtcaagagccgtgttacataa

Exon 10 +      38078      38183   2   Internal    106    72        Good
cgcctgaaccctggaggtggaggttgcagtgagccaagattgcgccattgcactccagcc
tgggcgacagagcgagactgtctcaaaaaaaaaaaaaaaaaagaaaagaaagaaagaaat
gaaaggcagtgttggggcaagttgctttacttttgtctgcctccattttctcatctctag
AGTAGGGGCTAGGAGTGGCACTGCTCATGGCGTCATGGTGAGGATGATCGTCATCAAGTG
TCTGCCACTCCTGCAGAGCCTGGTCCACGCTCAGTGCTCAGGCGAG
gttggctgtaggagagcataggcctctgcacacagatgcagggttctgtgctgtgcgtgc
tcgacttcaggatgggttaggcaggcgatttggtttggtacctcttaagtcagtgtctgg
ggagaccctagaagggaccccagggttctcaggtacctccacaaagagaatggcctgcaa

Exon 11 +      39863      39951   0   Internal     89    97   Excellent
gcttaacagcttagcatgttagtcatcatctttgtctttttgaatgcccatggaactttg
aatgcacttgttgtccatgctgtagagaattgctgtggaaagtaggtgaaaaagcacgat
gcttggctttcgggctgtcccgagagcagtctaaactgcatcccccttttcctcacgcag
AATCGCAAAGGTGCCGTGAGCGAGCTGGAGCATGTTCCTGACACAGTTTTGTGTGATGTG
CATTCTCACGATGGTGTGGTCATTGCGGG
gtaagccaaaccgtttccactgagtgctctgcatctgaaggtctttcatttttctcatac
caccctctgagtaccagtgaccttagcttcctttgagagcatgtacctccctcagttaca
gcccatgtggaagagggagagtctccgtgattctgttcccaaggacgtgagagcgcgcag

Exon 12 +      40029      40136   1   Internal    108    72        Good
ttttcctcacgcagaatcgcaaaggtgccgtgagcgagctggagcatgttcctgacacag
ttttgtgtgatgtgcattctcacgatggtgtggtcattgcggggtaagccaaaccgtttc
cactgagtgctctgcatctgaaggtctttcatttttctcataccaccctctgagtaccag
TGACCTTAGCTTCCTTTGAGAGCATGTACCTCCCTCAGTTACAGCCCATGTGGAAGAGGG
AGAGTCTCCGTGATTCTGTTCCCAAGGACGTGAGAGCGCGCAGCAAGG
gtgagaagcacatggtgtagagcggatctgtgatccatttgtctcaatatgtctttccca
gcttttaaatcactcttgtggcatgttatgtgagattttcattaaggcaaacagtttgta
ttttatgaagacataaaaaagtcaagcaaagataataagtgttggcacagacaggccctg

Exon 13 +      51943      52008   0    Initial     66    53    Marginal
ggttttcagtaggtctcataattaaaatttcattcaataaggtgttaagatgtaagactt
tatagagggttctctgggtatatggcaagcgctgttctagtctgtctgttccagtcattg
catgcacagctatgaacaaaacccagaccctgagctcagaagcttcaggctggtagggag
ATGAACAGTGAGATGATCACAGACATGCACCACTGCCATGACGGAGACGTCCAGGCTGCC
GTGAAG
gtagatcgtagtgcggtgtagtgtggcatgtgagggagaaaggaagtaaaggaaatggtt
ccagaagaaagattcatgcagtcaggtgttttgaagggcttggcttgtggggggaggatt
gaatggaagaagctccgaatcagggagcctgtagtagtcgggtgtgaatgtgaggtgttg

Exon 14 +      54893      55107   1   Terminal    215    76        Good
atttgaaattgtcaccattgtgctgtgagaatgtgaagcgtgttcacagccttctgtcat
ctagttgacattttctcctgttggagtcactcatctaaacagtgcctcagcagtggctct
acaccacccgattcttacttgtctgttgttgtaaggctctgtgcattttccccaccatag
CCCTGCTCTTCAATCTCCTTTTGGAACCAAGTGTGTCGTTCTCTTCCAGATATACATCAG
GGGATGTGAGAGTGTGGGACACCCGCACCTGGGACTACGTAGCCCCCTTCCTGGAATCAG
AGGACGAGGAGGATGAGCCTGGAATGCAGCCAAATGTCTCCTTTGTGAGGATAAACAGCT
CGTTGGCAGTAGCAGCTTATGAGGATGGTAAGTAA
ccacaaccctcctccctattaaggaaaaaaaaaagctttacaaaaattaagcagctgtgg
ccggctcccccctgtaatccctccatatgtacacgtgggcacacacacatgttcacacac
atacactcactcttgcttttatttgaagaagttggccaacaaccgtcaatgcattagtag

Exon 15 +      60547      60699   0    Initial    153    43    Marginal
cctcgtgccacagcattagggaatggcagtgtgcttcgaaacccgctccctggtcaccga
gtttgtcttgaaatctcgctctttggtgagaaatgagattacacacttcttaggtgcaaa
gaagtttttatttgtccccctcagtagagagaggagagacgcgatctggtgcatattagc
ATGAGGAAGCCTGGACGGGACAGCCAGCAGTCCTCTTTATATGGTGCCATCAAGCACGGC
AAAGTGGCTTATCCACCTCCGCAACACTCCCAGTGCAACTGTCTGAACGCACACATGCTC
CATTGTCCGGGACTGTGGCTGCCCTGGGCGGAG
gtgactatgatttctcatttactgacgtatcaacaatggacgggggtgggtctctccaag
ctgctttttagcggtgaacagtaggaccatgttttagttagacggctgtagagactaggt
acttctaaagttttacttaagattttgtttttagtaaaaaatagttcttcagttgttttg

Exon 16 +      63176      63382   0     Single    207    52    Marginal
ggtgtggaatttatggtgttaaatatagatagagaagtaaacagagatgtacatgtatgt
cgtatgtatatatgtttatgtgtgtcctggctttgtttgctgagaaggtgtaagagcatc
aacagcccagctgttgaaagtatcactatctactaaaaggaaccagggatgcttggagaa
ATGGTGGACTCCAGGGATGGGGCAGTGAAACCACACAGTAAGCCTGGACCATCTGATTGC
ACTGAAGTGAAGAAGTGCTTGAAGAATGATGACAACATGTCACAAGGACACATAAGTGAG
CTTGAAGATGTTCCCACTGGCCAAACCTGGGACAACTGGAGTATCAAAGTCAATATTGAT
AATAACAGGTTACAACCCATTGAATAA
aataggaatatatgagtatatcatgataaaaataaacagatcaataaataaaaagggagg
agagaaaagtttccttatagtagaatgtcaactaataaatgcagaaagcatgatgggatt
agaaaattacacattggcaaccatcacagtaataattgattcagacaaaaaatcaattga

Exon 17 +      65372      65467   0    Initial     96    69    Marginal
ctaaattggagctcctgagggctaaaggaaggacaacttgagcaacaaaacatgatgata
gtgatggactataacctatggataattaattacccatgagtccatattggtatcaataaa
tacttgaataaataaaggagaagagatagctcttccttacagtagtagttgaattgctgt
ATGGGAAAGGATGATGAAAATAGAAAGCCACCATTTGGCAAGCACCGTAATCATAATTGT
CGTAGGCAAGAATCACCAGCGGATGTTAAAATCAAT
gtgatgaatgtctctgtccgtttgggctgttataacaaaacagtataaactgggtgactt
ataaacaacagaagtatatttctgacatttctggaggctggaaagtccaagatcagggca
ctggcagattctatgtctggcgagagcccttccttccaggcagtgccttctctcacatgg

Exon 18 +      66091      66171   0   Internal     81    66    Marginal
gtaatgaaactttgatattatgtacctcctgatacataatgcactgggaaggcacaacac
cttctgattttaaatatgaggaaacagcagacaattgagaggcctacacaataaatgagc
agtacttttcaaaagtgtcagggtcatgaaggacaaggaatgactgagtaattgccccag
ATTGGAGTCGATGAAGGAGACATGGCAGCTAGATGCTATGTGGAATTCTGGATTGGATCC
TGGACCAGAAAAAATATGCTG
gtaagaggacaggttaaatgcaaataaaatctgtagattaaatatgttgcatcagcgtta
atttcctggcttccatcattctgctatggttatgtaataggttaacatttgggaaagctg
gatgaagctataactggaactctttgcataatttttataacatttttgtaagtctgaaat

Exon 19 +      71541      71649   0    Initial    109    71        Good
ctattatagagcattcttgtaattcagttattcactattcaagtccttgcagttttgaga
ttataaaagtagccatgatataactgtagtaactgataaattgaccatttataaaattag
ctttcactcaaacacccctccctgttagcttctgtatctattcctgcccactctgcccat
ATGCTTTTGGGGCAGATATCCAACAATACAGTTCAAAGGGAAATTGCAAACCTTGCAGAA
GCTGCAGGACTTTGTGATGTTGAAAGTGACAGTGAAAGAACTAGAAGTG
gtaattacatggataaatagaaatggcttttttattatttaaatatctttaaaagataat
tgcctgcttatgcaaaagtaataacaatgtatttaaggtttacaagatgtacaaataaaa
agtttgtaacatatgtagaaataaaaagtatgacagtaatagcacaaaggctggaaggga

Exon 20 +      75451      75647   1   Internal    197   100   Excellent
ttaccttcaggccatgtgcatcaggtatatatgaaacgtaagtgatttcgtgtttagact
tgggtctcatttccaaggtatctccgttaaaaaattttcctttgtgttgcatgtttttaa
aataattgaacatattaagtaaatttaaaattgttacctgcattgtttcttgctgcatag
GGTTTCTTAATATTTGGGATTTAAGGACCGGAAAGTACCCTGTTCATCGTTTTGAGCACG
ATGCAAGAATACAGGCACTAGCCCTCAGCCAGGACGATGCAACCGTGGCCACAGCTTCTG
CTTTTGATGTCGTGATGTTATCCCCCAATGAGGAGGGGTACTGGCAGATAGCTGCGGAAT
TTGAAGTTCCGAAACTG
gtgagctttttagtctggtcatcttattttctattcttagaatctctgggtctaatgtaa
gcacgtactaatggtgttggtaactcccattcactcagagcttcctgcgggccttacctc
cataagtctaactacagccttacaaaataggtagtagcattttccccatttaccaagaag

Exon 21 +      77398      77516   0    Initial    119    47    Marginal
ttttaggaattatttttcactttgagtgaaaggttcccacaaaatgctctgagtatcctt
ggaaaaggcacccctggcccgaagagccaagccagttttgtcttgtccatatacgcccct
gaatggcagtggcagtgttcccaggtctgcgatattagcctagtgcggctgtcctttgtg
ATGGACCCGCAGCTTGCGGAGCTGGGCCCGAGTATTAGCAGAGTCCCCCGGATGTTGACG
CTCCCTCCAGCTCTTCTGGACCGTGTTCTGGAGGCCGGCTTTGAACTCTTTGGCATATG
gtcagggcagcgctgtcctttcacactgtggattttcataattagtgtggctcaccttct
atgtgtcctctcgtgatttactcgcagaggcgaaagcctgttgcgaacggcaccgcggag
aaatgggccgcctgtggatggacagaatcaaattattcttgaaaagtgcgtctcagactc

Exon 22 +      78908      79098   0   Internal    191    94   Excellent
atactgagcatcttttctgttgtgtaagagctgtttgtgtttcatttcctgtgagtgttt
catttgcccatctttttctgttgggttgctggtcttctcattgatgtgtaggtggaattg
catatttttgatcaagtcaggatgaatttatgggactaaacaactcttaccttttaacag
GTTCAGTACCTTGAAATAGTTCCAGAAACCAGAAGGTACCCTGTGGCAGTAGCCGCTGCT
GGAGATCTGATGTACCTGCTCAAAGCCGAAGACTCCGCCAGAACCCTCCTTTACGCCCAC
GGCCCGCCTGTCACATGTCTAGACGTCTCGGCCAACCAAGTTGCTTTTGGTGTACAGGGT
CTGGGATGGGT
gtacgaaggaagcaaggtacacaactagcaagatatataattaacaaaaaagaatataga
tttattttttagaagggaattgaaaaattaaagctcttcaatatttttccagatatatca
ggccagtatataagcatggtcaaaaaattcaagaacttcaaaaggattgcaaatgaaaag

Exon 23 +      80910      80985   2   Internal     76    76        Good
gaccattttgctttctaatttttcatctggtatgctttcaagtttgtgttatctcattta
tttttagagctctcagtatagagaggtgatagttatattcagtaccagtctggtttaaat
ttttcatactttttataaatgttttctccttgacttatctgaatggatttattcctgtag
TAATACAGTTGTAATGGATACATTTGAGAAACTACTTAAAGGGACAGTTCAGCACAAGGA
TCCTTCAGATACAGAT
gtaaggcagtggggtttttttgattcctctcaaaatttccaactcaactaaaagcattaa
ctgtaagaatcagctgataaacacattaattttgtgaaaaatccttggttaaaaatgtat
agtccctggctgggcacagtggctcacatctgtaatcccagcactctgggaggccaagtc

Exon 24 +      87397      87495   0   Terminal     99    73        Good
tgaacttggtgaattccagactgatagaaaatcatgtagataaataaatgaggaatgaac
attcaaatgcattttgtacatgtttaatattaaaatagtatccatagttgatataattgt
tagtatatggttaataataaataataaatacagttcttctcacttgtgaaaaccctgtag
CACCTCCACAGAGCCCTAGAGTTTCTCAAGACAGAGCGAGAAACCTCTGGCTTAGATGCT
TTTGAGGACTGGACCATCTCTGATACTCTGTACAACTGA
tgggttattctgtgaaaagtgtcgtttggaatattgcatcttattacagaagccatgatc
tttaggatctctagggatcctggaagggagtgataaagttacagaatgtaaatatagggg
aaagttcctttcagctatagtcaagatagcagttgtgtcaccactggagactgagcaagg

Exon 25 +      92359      92815   2   Terminal    457    50    Marginal
aaagtaggcctggccttcctttattattcccagcacctacggacgtgctgagagagagag
attggccggtttggatggtttttgcctggatttgtacccgagtgtactcttgctctgtgg
gttcctttcaggcttaggtcacaataggtgttggtttggcctcactccggtcctttgtag
ACATCTGCCCACATCACAAAGCCCCCATGTTTGGCACAGCCCGCAGCAGTTGGCACTGCC
TGCCCGGGAAGAGTCCAGTCCTGGAACAGCGGGGGTTGCAGGTGCATTGGCACGTGGTGG
TGGGGAGCGCACACAGGCCTTGCCTACCCAGCGCCTGGCGACGCTCAGCAACACCGTCCC
ATCCCTGAAATATCTTGGCCTCGTGGGCTTGTCACTCCAATTAAAACTTAAACATGAAAG
CGGCTCAGGCTGCTTCTCCCTTTGTGCTGAATTTGAGCATGGACGGTGCCAGAAGCATGT
CGTGGAGACTGTTAAGGGGTGCCATGTTGCAGGGAACGTTGAGGGGGTCAGGGATCCATT
TCTTCAAGATTTGCATCTTGCCGGTTGCTGCTGCGAAGTGCACCTGAAAGGCAAGCTTCT
GTTTGCCAACAGAAAGTCACCTTTGGGATGGTGGTGA
aagtcattttccacatgttcacagatacggccgtgttaccaagcctcacgctatgactta
tctctggcaaggacttacaaaatagtctctctggctgattgtcaaaaattacatcatatc
ggagtaaactgcttttaaatcagacatccattattcatgtatattaactgcatttttatt

Exon 26 +      95800      95912   1   Terminal    113    80        Good
taattgccacatgaatgaatgaatgataggatctctgtccccaggaaccttagagttagg
aaccttagagttgaaacctaggagagtgttacaacgtgtagtgtgatgcggtgtggtgct
tggtaatagtgctgcagagcctcccctgacctgctggagtcaccgcctcctcccctccag
TATCTGAGAACCACAGATCTGGGGAAGAGCCGGAAGAAGATAAGACACAGGTCAGGGTGA
CCTTGTCGAAACACCACGTGATGCGTGCAGACAGCAAGGACTGTCAGCACTGA
ccaggggaatgggcactatgtgccaaggacatcatggagaagagagcacaaaggcagctg
gagtggacggaaaagaagagagcaggcggtttaactgcctcactgcccagcatctggcct
ctgatcacaacttccctgttcagaagagccaagagccacatatgtgaggcaggttactag

Exon 27 +      95930      96075   0    Initial    146    76        Good
gctgcagagcctcccctgacctgctggagtcaccgcctcctcccctccagtatctgagaa
ccacagatctggggaagagccggaagaagataagacacaggtcagggtgaccttgtcgaa
acaccacgtgatgcgtgcagacagcaaggactgtcagcactgaccaggggaatgggcact
ATGTGCCAAGGACATCATGGAGAAGAGAGCACAAAGGCAGCTGGAGTGGACGGAAAAGAA
GAGAGCAGGCGGTTTAACTGCCTCACTGCCCAGCATCTGGCCTCTGATCACAACTTCCCT
GTTCAGAAGAGCCAAGAGCCACATAT
gtgaggcaggttactagggatcagaaaagaaagtgggtagatggtatcatcttcaggaag
tgtagtcacatcttcctctcgtgcctcttctcttatactccactcagcccagcacagcac
ctcctaacctttggctctctttgccactgcccttttttaaatggcggccaacaaatcatc

Exon 28 +     100568     100807   0   Terminal    240    90   Excellent
cttaatagccatgtccctatactatcagtaacctgaaaaagatcaggaaattaagtggca
gaacatcttcacgggagctcagtgataaggatcatgccctccacgatggtgaaatgaaag
tatttgatgtcggcctggtgtgtggaattgtgggcccacacatttctcttcctctctcag
ATCCTGGTGTATAGCCTGGAAGCAGGACGCCGCCTCTTGAAGCTGGGTAACGTTCTCCGT
GACTTCACGTGTGTCAACCTCAGCGACAGCCCTCCCAACCTCATGGTCAGTGGCAACATG
GACGGGAGGTACGTGAGTTGGAAGGGCATTGCCTTGCAGCCCCATGGCTTCTGCCAAGGC
CCGGCCCCCACTGCGCTGCTCACACTGCCCGGTTCTCACTCAACAGCTCTGCCCACCTGA

gttcagccccgatcccataaacactctagactcagagaacaaagtcctgtattaggtaat
agttggatgtagctatgtctctgcttcatttctgaagcaccacgggaaggttttctttta
agccatttggtggccgcagttggtagaaggtccagggagaccacttggaatatcttttgt

Exon 29 +     103527     103629   0    Initial    103    59    Marginal
gcatggtgacgcatgcctgtaatcccagctactcggaggctgaggcaggagaatcgcttg
aacccaggaggcggaggttgcagtgagctgagatcacaccactgcactccagcctgggtg
acagagcgagactccatcatctcaaaaaataaagaaaaactaaaaaataaacagagtctg
ATGAAGAGCAAGAGAAAGATTGGGGTGGAAACTGAGTTAATGTTAGAGTATGCTTTTCCC
TCGCTGGGAGGGAAGGCTTGTAAAGATGGGAGCGGAGAGAAAA
gtgagattttgcataggagttttatcagtgtagatcaatgagtttttctgaaggcatatt
ttgtctcttctcgctaagactaagaagaaagagcaatgagtaatggtacggggagtgatg
cacgtcggcattagggctggctgctcatgtccattccactcaccacactctctctggtac

Exon 30 +     111143     111251   0    Initial    109    85        Good
aaccacggagctgagcctggcgcttgccagcagcctcccctcccctgaagtcgcagctca
ccctctcctgtctggttttcagctcaggtcctggggaagtcacttcctacgtgagctcag
cagtgcccttaaaaggattttatccagcatttttaagcgttttacagtggaactgtcaac
ATGTTGTCTGAAACAGAAGCCTCTTTTGCAACTAAGAGCAGTGACTGGCCTTGCGTGTAT
GTGGACTCTTGTGTAGCTACCTCCTCGAAGTGGAATTGCCGGCTCAGAA
gtgaggtgcatgtggtatttggttggatattgccaagtcactccccagagaaggatttct
gctcgcctcagctgtctaggagtacctacctgtccatgtctccctgccacacagtgcctc
gtagggcatgttaccaaactttacctttgctgggtagattggtgacaagtggcattgcat

Exon 31 +     114392     114565   2   Internal    174   100   Excellent
accgtgtgggtcctccctgacagtctgtgcttgatgtccttattatcgatgtttgtttgc
agctgaggagtttttcatagcagtgttgtgcatagaccagcaccgtggagggggagtttg
tcatttgaagctttgactctaaccccatttcccttctctgctcttcctgggcctgtccag
GGTGAGGATCCACGACCTCCGCAGTGGTAACATCGCCCTGTCGCTCTCCGCCCATCAGCT
CAGGGTCTCTGCTGTGCAGATGGATGACTGGAAGATCGTCAGTGGAGGCGAGGAAGGCCT
GGTGTCCGTGTGGGATTATCGGATGAACCAGAAGCTGTGGGAGGTGTATTCCGG
gtaaggtgcattctagacactcttgggagttcctagtaggaacagggaaggcagcactaa
tcagcctgcaccaggcacggtgctaaatgccccctaccccccggcttcgccaggtgaatc
cttactgtgaccctaggagccagctgctgtcccagcaccgctctgcagaggaggaaacag

Exon 32 +     114702     114843   2   Terminal    142    70        Good
tgggattatcggatgaaccagaagctgtgggaggtgtattccgggtaaggtgcattctag
acactcttgggagttcctagtaggaacagggaaggcagcactaatcagcctgcaccaggc
acggtgctaaatgccccctaccccccggcttcgccaggtgaatccttactgtgaccctag
GAGCCAGCTGCTGTCCCAGCACCGCTCTGCAGAGGAGGAAACAGGCTTGGAAATGGCGCT
GGTCAGTGGGGATGCAGTTCCTGTCTCTGACATCATTCAGATCGCCACAATTCCTACATT
AGCCAGGCCCAGCTTTCTCTAA
gaatgaaactacttttttgcaagtgctattctgattattttaggatttctccatcttaat
aaacagaaaagggaactcaaaaacataggaagctcgctgggctagaccaggatgtgacac
cccacctgcccacaggtggaaggcagggctggcccagctgctgtcctccactcgagtccg

Exon 33 +     117639     117749   2   Internal    111   100   Excellent
acctgagcttcgggaactgaggtgagacactgcttccatgggggccctgttccctctgtg
aaagagaagcttagctttatgggttctagaatcccctgcagctctgaactcccaggcctg
cggcagcaagtgcaggcccagtggacgcccccttacgagctctctcccactgccttccag
GCACCCGGTGCAGCACATCTCATTCAGCAGCCACAGCCTCATCACGGCCAACGTGCCTTA
CCAGACGGTAATGCGAAACGCCGACCTGGACAGCTTCACTACTCACAGGAG
gttagtggtggggccgggcgagtaagagaccatcttagtttgactgatgtatagaacccc
accccccccgccgtgacacattgcaccctatgggctataccctcaggcagggccctgcct
ttctgcgaattggaaacataaacgtggatgctgacctgtactgagcacccagcatctgat

Exon 34 +     118147     118219   1   Internal     73    63    Marginal
tgtacagagagggagggcaagccgtatgctgaggggcctgctgtggttagaatcctgtca
ggggcaaggcccgccctcttgagtccttgccctgtgacactcactgcgcccatcggactt
gtgcacccccacgttgaccgctaagccggggactgtgagtatctgacgctgtgtgcccag
AGAACGCGTTTGTGAAGCTGAACCTCTATCTGGTCTCAGGCGAACGCCTCCTGCACAGAC
AGAAGCGGCTGGG
gtgagggccagcgaggcagccctgacctgtcaccatctttgtgctctttctagacaccgg
gggctgatccgcgcctatgagtttgcggtggaccagctggccttccagagccctctccct
gtctgccgttcatcctgtgacgccatggccactcactactacgacctcgcactggccttt

Exon 35 +     118273     118411   2   Internal    139    89        Good
ccccacgttgaccgctaagccggggactgtgagtatctgacgctgtgtgcccagagaacg
cgtttgtgaagctgaacctctatctggtctcaggcgaacgcctcctgcacagacagaagc
ggctggggtgagggccagcgaggcagccctgacctgtcaccatctttgtgctctttctag
ACACCGGGGGCTGATCCGCGCCTATGAGTTTGCGGTGGACCAGCTGGCCTTCCAGAGCCC
TCTCCCTGTCTGCCGTTCATCCTGTGACGCCATGGCCACTCACTACTACGACCTCGCACT
GGCCTTTCCCTATAACCAT
gtttagggatgtgcctcagttgggagcaaggagaaaaatgggaagaaccagttttatcca
tcttaaaacgccaggcacctcttcacaggtggtaaacatttaggggaagaaagcagccca
gggtgccatgcctgacagcacgcatctccctgacccctgcacttcccccagcgcctgggg

Exon 36 +     120219     120333   1   Internal    115    84        Good
gagacgggggatattgctatgttggccaggctggtctcaaacttctgacctcaaatgatt
gcctgcctcagcctcccaaagtgctgggattacaggtgtaagtcactgtacccagcccaa
aagcagtttaaaaaaaaaaaagacaaaatatacaactcttgataaaacataaaggtacag
TGGTCTATGAGGAAGAGAAAAGGTACCTGAGGATGCAGAAGTACCTACCACATGGGAACC
GTTTGTCCACACTCATTCCAGAGAAAACCGAGTCCTCTCAGTTGCACACGTGTAC
gtatcagtgggaagtgcttgccattactccaaagcctagaaccttcacgtcatgaaggtt
ctggaaggtttttcagattgcttaagatacgcagccattccatattcatctccaactaca
caggggaacggagcagatagagctgcgactgggaagcgtcaccttcccgtccagagcgct

Exon 37 +     121223     121355   2   Terminal    133    70        Good
ttctactgcaaacctccacatcctggaatcaatcacactgacagggaaaggataaatgct
cctttataagccaacatgtatccaaattaagcccccttacctttatccagaccctttcac
aaacaagttctgagtttttagccaattgatcctctactttccttctttagtccctctcag
GGACGCCTCCATCCCCGGCTCCCCTAAAGGTAGAAGATACTCGAGCATGCTGCCAGGGGA
GCTGGATGGTGAAACACCTGAAGATCTCATATCGCCTCTCAAAACACTGTCGGACTTGCT
TTCTGCTTTATGA
tgtccgtagttgttctaatattaaatgctttgaatttctttattggtcaagttattttaa
cttgggcaaggcatacagtgataatcccctggcatgccacgattccagctcttcccaccc
ccttgaaatcttacctcccaccgtggtggttttgtaaacccacagtcaattggatttgcc

--------------------------------------------------------------------------------