--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13545 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4560       4801   1   Terminal    242    70        Good
cccagcgactggccctggagccagagaggtgtagtgaccaggatcagaacccaggtctgt
gccggcagagcctgtgttcgccatgccatgcttgctgccacatcagaagctcaggaaact
ggggtttggctgatgtagttagggggctctgggggacatcaccctgcccaattcctgcag
TGGCCATGGACGTGCCAGATATCGTGGGCGTTGTGCGTCCCCCTCCCAAGCAACCCGCCC
CTATAGCGCACGTGTCTCATCATCCGCATGTGTCTCATCATCCCCACGTGGGAGGCGTGG
AAACTGAGGCTCGGAGTGGCACGGTGCTCTGCCCAGTTCAGGATCCAAGTCCACGTTTGC
AGTTCCAGCCCAAGCTGGAGCATAACCCTGGGCTGCAGTGGCAGCATCCAGGGCTGGCCT
GA
gactcaggagacagctcggaacggtccccgttctcggagagaggggcaggtgccggggta
gctggctccctgctttggtctcctctatgctgtgtgccctggggccaccccttcaggtcc
atttctctaaatcgaggggcctggagccagggttctccagtgctcctcccggctccccca

Exon  2 +       6059       6156   1   Internal     98    98   Excellent
tgtagctacatttcattatccatcttatatgctggtcaaaccggaggtggagagcagggt
tctccatcctgctacagttggtggtgtgggtcctgggcaagggctgttgcaggacccgga
gtccttgccttggtacaactggctgagctgactcctggcctctctctccccaccccacag
CTGGGAGTGTCCACTCGCCTTCCACCAGCATGGCAACGTCTTCACAGTACCGCCAGCTGC
TCAGTGACTACGGGCCACCGTCCCTAGGCTACACCCAG
gtatgtcaatgggggtgatggcatggtgggagggccagggggagacatgcttcccaccat
cagaggagagaagttggtggaagagacgaaggagcagaaaggatgggacggagctttctc
agcccaaggccctggctgcgctcctgctcagaacacatcagagtggagggcactggggac

Exon  3 +       6879       6956   0    Initial     78    73        Good
ctcctcatcagcccaagggtgatcctagtacccccagcccaggctggcgaacagcaggaa
tggggccgccaccatctcagctgcaccctacatctccaagggatgagccgccccggggaa
ggtcccagcgggaagatgctctccctggctgggccccagcaccagtgttctgaggtcgct
ATGGAGCCTGTTCCTCGCCAAGTGGGCGGCTCCCCGGCCATGCCCCACCAGGCTGCCCTG
CCCCAGGAGGAGAAGCAG
gtgtgggcctgtgagcgggaccggctgaagaagcggtggctgtgggaggccaggcagagg
ggcagccgggagttggcagtgccacgttctggccatgcgacggcggcgccaggacaggcg
ggaggcccgtgaggcctggaggcagtgccgtggggaggcagagcagccggagcaggacga

Exon  4 +       8019       8171   0   Internal    153   100   Excellent
gagatggagtctcgctctgttgcccaggctggagtgcagtggagtgatcttggctcactg
caacttccacctcctgggtccaagcagttctcctgcctcagcctcctgagtaactgggac
tacaggcacgcaccaccacgcccggctgattttgctgaacccatttctttctgattctag
GGAACTGGGAACAGCCAGGTGCCCCAAAGCAAATACGCGGAGCTGCTGGCCATCATTGAA
GAGCTGGGGAAGGAGATCAGACCCACGTACGCAGGGAGCAAGAGTGCCATGGAGAGGCTG
AAGCGCGGTAAGCCCGGCCCCGCTGCCCTGTCG
gtgaccacagtgctagacctttaactctggaaagacttttggggaaaatgtgggaaggtg
ggctagggatgaggctcactcatgggagctcctgtcttgttacagagttgccgtctgtgg
tggaggcctcaggcaggcgatgggtctggtagcgaggggcctggggggctggatgtcttc

Exon  5 +      13344      13442   0    Initial     99    48    Marginal
gggagctaagaacataaagtacattgatttctttaccacggctagcagataattaggaat
gttagcacaggtctttgaataaattttgcttcgaagagaagttaccgtttattccaaatt
aaatggggaggaaagtctttggagaggaacctctactttaccttttacaagaggtaggag
ATGCCTGTTCAAACTGTATTTTCCCATCTGACACGGAAACATTTTGGTGATATCATTAGC
ACAGTTGGCTGGGGAAAGAATGTGTTTGCTAAGTCAGAG
gtagggataaagtgaagttgcattatgggtgtattttaagtgcagcaaacttaagtgtat
gctaggaaaaaaaaatagcagcagcagtttttaaaaaaaaaata
--------------------------------------------------------------------------------