Gene TSSC4 Variant 1
DNA : 1.58 KbNT_009237
mRNA : 1423 bp NM_005706
CDS : 990 bp NP_005697
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  158 bp
agcctgcctgcagagggttggcaccattaaatgaggtaacgagtcaaaagtccctaccct
gggtcctagcctgtcaggggctccgaaaacccaggctcaggtcggtcctgcccggcacct
gtttcacacatgtacactccggtctgaggttggtcctctcccccaccccacccacctgca
GTTGAGCAGCTGAACAGAGGCCATGCCGGGGCACTCCGAGGCCTGAGACGACCACGCCTG
TGCCGCTGAGGACCTTCATCAGGGCTCCGTCCACTTGGCCCGCTTGGCTGTCCAATCACA
CTCCAGTGTCAACCACTGGCACCCAGCAGCCAAGAGAG
gtgagaggagggcttggagggggaggcgggactccaccctgtgtgggacagttctgtcag
ttgaccctccacttgtccaggggcagtggatctgcagggggaactcattctcaatactgt
tcctcctgagaaacaaattttctgggctgttttggtttaggtgtggcgtggccctgggga
EXON 2  1265 bp
gcacccagcagccaagagaggtgagaggagggcttggagggggaggcgggactccaccct
gtgtgggacagttctgtcagttgaccctccacttgtccaggggcagtggatctgcagggg
gaactcattctcaatactgttcctcctgagaaacaaattttctgggctgttttggtttag
GTGTGGCGTGGCCCTGGGGACGCATGGCTGAGGCAGGAACAGGTGAGCCGTCCCCCAGCG
TGGAGGGCGAACACGGGACGGAGTATGACACGCTGCCTTCCGACACAGTCTCCCTCAGTG
ACTCGGACTCTGACCTCAGCTTGCCCGGTGGTGCTGAAGTGGAAGCACTGTCCCCGATGG
GGCTGCCTGGGGAGGAGGATTCAGGTCCTGATGAGCCGCCCTCACCCCCGTCAGGCCTCC
TCCCAGCCACGGTGCAGCCATTCCATCTGAGAGGCATGAGCTCCACCTTCTCCCAGCGCA
GCCGTGACATCTTTGACTGCCTGGAGGGGGCGGCCAGACGGGCTCCATCCTCTGTGGCCC
ACACCAGCATGAGTGACAACGGAGGCTTCAAGCGGCCCCTAGCGCCCTCAGGCCGGTCTC
CAGTGGAAGGCCTGGGCAGGGCCCATCGGAGCCCTGCCTCACCAAGGGTGCCTCCGGTCC
CCGACTACGTGGCACACCCCGAGCGCTGGACCAAGTACAGCCTGGAAGATGTGACCGAGG
TCAGCGAGCAGAGCAATCAGGCCACCGCCCTGGCCTTCCTGGGCTCCCAGAGCCTGGCTG
CCCCCACTGACTGCGTGTCCTCCTTCAACCAGGATCCCTCCAGCTGTGGGGAGGGGAGGG
TCATCTTCACCAAACCAGTCCGAGGGGTCGAAGCCAGACACGAGAGGAAGAGGGTCCTGG
GGAAGGTGGGAGAGCCAGGCAGGGGCGGCCTTGGGAATCCTGCCACAGACAGGGGCGAGG
GCCCTGTGGAGCTGGCCCATCTGGCCGGGCCCGGGAGCCCAGAGGCTGAGGAGTGGGGCA
GCCACCATGGAGGCCTGCAGGAGGTGGAGGCACTGTCAGGGTCTGTCCACAGTGGGTCTG
TGCCAGGTCTCCCGCCGGTGGAAACTGTTGGCTTCCATGGCAGCAGGAAGCGGAGTCGAG
ACCACTTCCGGAACAAGAGCAGCAGCCCCGAGGACCCAGGTGCTGAGGTCTGAGAGGGAG
ATGGCCCAGCCTGACCCCACTGGCCACTGCCATCCTGCTGCCTTCCCAGTGGGGCTGGTC
AGGGGGCAGCCTGGCCACTGCCTAGCTGGAATGGGAGGAAGCCTGCAGGTGGCACCGGTG
GCCCTGGCTGCAGTTCTGGGCAGCATCCTCCCAAGCAGAGACCTTGCTGAAGCTCCTGGG
GTGTGGGGTGTGGGCTGGAAGCACTGGCTCCCTGGTAGGGACAATAAAGGTTTTGGGTCT
TTCTG
agactttgtgtctatctgggccctgcttacccaaagggctcagttggcagcaagagctcc
ccacacctgaccctcggtgccggaccactcgagggtggctgacacctgcatccctcacca
gcacatcacccaggtgacagtgagaattggaaaccccaggcctcctctagggcttgtggc