Gene THY1 Variant 1
DNA : 4.97 KbNT_033899
mRNA : 1772 bp NM_006288
CDS : 2604 bp NP_114404
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  32 bp
aatgcgggaccgccttctcttccttccccaccccccaccccaccctgccgtcctttctcc
cccaatctccgcctctgattggctgagcccccggctccccgctccccctctcctccatcc
ccggtgaaaactgcgggctccgagctgggtgcagcaaccggaggcggcggcgcgtctgga
GGAGGCTGCAGCAGCGGAAGACCCCAGTCCAG
gtgggaactggagccggtgggacctggggctcggggaccgccgtcaggcgcccatgcaag
acttcccaacactaggcttcgggccacggtccgagggcgcccagggaagaagggcgcaga
gcttagggaggggcctgctttccaggcaggggcgggagggggatgcttctgcagggcagg
EXON 2  61 bp
tccctgagcaggaaagagccagtggcagtatcatgttcagtgagatgcagggacgagagg
gggaatggagagagggacttagatgactgccatagccactatgccatgttcccagggacc
cccagccctggtggtaagtgtggcacagcttggctgattcccatcctgttcccaccccag
ATCCAGGACTGAGATCCCAGAACCATGAACCTGGCCATCAGCATCGCTCTCCTGCTAACA
G
gtacccggcatggggcaggactggggctccaggcgccctggcttccttccctccagagaa
gcagcttctccctcacagtctcagaaaagcgcaggtgacaaagagagggctctttttcat
cctgaagtcagccaatccaccgcgctgatattctgacggcctgaggtggtttttgaaaac
EXON 3  336 bp
cagagtggggagggaggctggggtctgcaaaggagaagtgggatccctggggtggggaaa
ggcactcagagagcagaccccggtcccctccctagccaggcccatctctccacttcaggt
gggtgggaggcccctgtgccgcaggcccctccagtttgaaggaggcactgctggtgccag
TCTTGCAGGTCTCCCGAGGGCAGAAGGTGACCAGCCTAACGGCCTGCCTAGTGGACCAGA
GCCTTCGTCTGGACTGCCGCCATGAGAATACCAGCAGTTCACCCATCCAGTACGAGTTCA
GCCTGACCCGTGAGACAAAGAAGCACGTGCTCTTTGGCACTGTGGGGGTGCCTGAGCACA
CATACCGCTCCCGAACCAACTTCACCAGCAAATACAACATGAAGGTCCTCTACTTATCCG
CCTTCACTAGCAAGGACGAGGGCACCTACACGTGTGCACTCCACCACTCTGGCCATTCCC
CACCCATCTCCTCCCAGAACGTCACAGTGCTCAGAG
gtgagacaagcccctaacaaggtcaagtgagctgggagagccaggctcggggacagcagg
cagttcccttggctggactagagaggagaatagccccataacgctctcaccctctcccaa
ctgctgcctggtcaactggggaaccattgccttcggtgtgaatggggtgaagagctcagg
EXON 4  1343 bp
agtaatctgcaaatgggaaagatggctggttctgtgagaccgggctgttcctggtcccag
ctaagacattgcagtacccacctcccaaagggagtacacccttgctttgggcctgtgcct
gcctgagtcctgatccgtcttccttcctaccctgcccccggcccccttctctttctgcag
ACAAACTGGTCAAGTGTGAGGGCATCAGCCTGCTGGCTCAGAACACCTCGTGGCTGCTGC
TGCTCCTGCTCTCCCTCTCCCTCCTCCAGGCCACGGATTTCATGTCCCTGTGACTGGTGG
GGCCCATGGAGGAGACAGGAAGCCTCAAGTTCCAGTGCAGAGATCCTACTTCTCTGAGTC
AGCTGACCCCCTCCCCCCAATCCCTCAAACCTTGAGGAGAAGTGGGGACCCCACCCCTCA
TCAGGAGTTCCAGTGCTGCATGCGATTATCTACCCACGTCCACGCGGCCACCTCACCCTC
TCCGCACACCTCTGGCTGTCTTTTTGTACTTTTTGTTCCAGAGCTGCTTCTGTCTGGTTT
ATTTAGGTTTTATCCTTCCTTTTCTTTGAGAGTTCGTGAAGAGGGAAGCCAGGATTGGGG
ACCTGATGGAGAGTGAGAGCATGTGAGGGGTAGTGGGATGGTGGGGTACCAGCCACTGGA
GGGGTCATCCTTGCCCATCGGGACCAGAAACCTGGGAGAGACTTGGATGAGGAGTGGTTG
GGCTGTGCCTGGGCCTAGCACGGACATGGTCTGTCCTGACAGCACTCCTCGGCAGGCATG
GCTGGTGCCTGAAGACCCCAGATGTGAGGGCACCACCAAGAATTTGTGGCCTACCTTGTG
AGGGAGAGAACTGAGCATCTCCAGCATTCTCAGCCACAACCAAAAAAAAATAAAAAGGGC
AGCCCTCCTTACCACTGTGGAAGTCCCTCAGAGGCCTTGGGGCATGACCCAGTGAAGATG
CAGGTTTGACCAGGAAAGCAGCGCTAGTGGAGGGTTGGAGAAGGAGGTAAAGGATGAGGG
TTCATCATCCCTCCCTGCCTAAGGAAGCTAAAAGCATGGCCCTGCTGCCCCTCCCTGCCT
CCACCCACAGTGGAGAGGGCTACAAAGGAGGACAAGACCCTCTCAGGCTGTCCCAAGCTC
CCAAGAGCTTCCAGAGCTCTGACCCACAGCCTCCAAGTCAGGTGGGGTGGAGTCCCAGAG
CTGCACAGGGTTTGGCCCAAGTTTCTAAGGGAGGCACTTCCTCCCCTCGCCCATCAGTGC
CAGCCCCTGCTGGCTGGTGCCTGAGCCCCTCAGACAGCCCCCTGCCCCGCAGGCCTGCCT
TCTCAGGGACTTCTGCGGGGCCTGAGGCAAGCCATGGAGTGAGACCCAGGAGCCGGACAC
TTCTCAGGAAATGGCTTTTCCCAACCCCCAGCCCCCACCCGGTGGTTCTTCCTGTTCTGT
GACTGTGTATAGTGCCACCACAGCTTATGGCATCTCATTGAGGACAAAGAAAACTGCACA
ATAAAACCAAGCCTCTGGAATCT
gtcctcgtgtccacctggccttcgctcctccagcagtgcctgcctgcccccgcttcgctg
gggtctccacgggtgaggctggggaacgccacctcttcctcttccctgacttctccccaa
ccacttagtagcaacgctaccccaggggctaatgactgcacactgggcttcttttcagaa