Gene SYTL2 Variant 2
DNA : 20.85 KbNT_033927
mRNA : 2731 bp NM_032379
CDS : 1131 bp NP_115755
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  725 bp
accataagaaaagcttagatgttgtgattcttagaaaaagaagaaaatagttttctaact
aggtgtatgcaaattaggattataatttatcctcttcttgtaccttctacacatatactt
tctatatcagaaagaagacatatgctacattttcttattaaattcttagagtaccctaac
TTTAACCATTCTAACTTTGCCTTGGGATATTGAAAATTCTGAATCAGTGAGGTATCTAAA
TAATTTATATTTTCAAAAAATAATGTTTATTTTATAATTCTGAGTGTAAAACACTATCAG
AAAAGTAATCCTCATGCTCACTAAACAAACCTACTCTAAGACACTCAACAACCAGAACAG
TTTTATTATTGAGTTGTGTACAAAAATCTTGACTGTCCAGATGAAATAGTTTTTCAGCCT
GCAGTGTGTTAGTGATATATCTCAAGGAGATGAACCAATAAAGTACAGACTTTGTGGTCT
GAAGCTCTGTTGTGAAAAAATAAGCTAAACCAATTCACACTGACAGTATAATTTGATTCA
AGTGCAGCTCCAGTTCAATAAAAACTAATGTTTTTAAAATTAACTTTGTTTTGTATTTGG
TTCAACTCCTTGCTAGTTCTCTCTCTATATAATTTATAAAAACTGCATGTTGCTAATCTC
ATGATCCTGTGCATGTGGACTACTCTGCCTTTAACTTTTTTACAAAAACATGTTTGTTCA
TAGATTAAATAAAAGTATGTTTTCAACTTAATGTCTAATGTTTTCTGACAATTGTAAGAA
TAATTTTGAAATGGAAATGCTGCTGTTTAGTTTCCACAGTGCCTACACAACCTGATAATC
CATTTTCTCACCCTGACAAACTCAAAAGGATGAGCAAGTCTGTTCCAGCATTTCTCCAAG
ATGAG
gcaagtttgtcttttgtaccttcagaaaaatggagacagagggttggaattgctatgcca
aggttggtgtgtttgtattccactgtggcagagatcaaagaggtcagaaggactggccct
tgcctttcaagtcaatagaagtagtgttgttcatcctggaacagggaaaggcacatctca
EXON 2  120 bp
gaggtcaaggcagaccacccactccatcctgaatcccataccctggcaattagcactagc
atcctttgaccttgcgtaaatgtcagtggaataccaaaatctcatctttgcctaaacaga
gattctgatcttgactcattctgaatttaaatattgtgcatattatatgctgttttgtag
AGTGATGACAGAGAAACAGATACAGCATCAGAAAGCAGTTACCAGCTCAGCAGACACAAG
AAGAGCCCGAGCTCTTTAACCAATCTTAGCAGCTCCTCTGGCATGACGTCCTTGTCTTCT

gtatgtaaacaaaggctccatattaatatctctccgcgtctctgaaccttgctctgacat
gctcatgctcattgtaaaacagcctcctcctgtatttctcagggcacaaacagtttctct
aatccataattagcttctggctagctacatctatctttttttttttagactaacggggtt
EXON 3  170 bp
aactctagtcatgtatatcatgtcaggttgtctttatagatatgtctttatgctatattg
aattaactgcttttataagcaagctaaagaaataatgccagcagggattatatccatgat
ccttgtgctaggtttaagaatgagatagagacaaacactatgtatttctgatgctttcag
GTGAGTGGCAGTGTGATGAGTGTTTATAGTGGAGACTTTGGCAATCTGGAAGTTAAAGGA
AATATTCAGTTTGCAATTGAATATGTGGAGTCACTGAAGGAGTTGCATGTTTTTGTGGCC
CAGTGTAAGGACTTAGCAGCAGCGGATGTAAAAAAACAGCGTTCAGACCC
gtaagtacattttagagtcacctaccttctcttagttctccaactgtcaatcttacagga
attggaaggaaataaagtaatcaagaggagggagggtatgtgttaagaggaatgtttgaa
aagttggggggaaatgctgttttattctataaattcatatgtcaaacattaaattataaa
EXON 4  103 bp
actaaaaccctttacacatttaagtataaaggtattggtaggaaaatttgttattcactg
cttttctcagtgtcatgaaataattatttctgctgtcagttttcaatgtatttaaaaaac
tagaggtggaaacataacttttattttctttgactttgtctgttcaattctccttttcag
ATATGTAAAGGCCTATTTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAAACACTCGT
AGTGAAGAAAACCTTGAATCCTGTGTATAACGAAATACTGCGG
gtatctatgaactctctctataggaaaatcctagatggtgacctgtttaccatgtcttct
ttgggtagtagctctacaggataaagtcagtcaccaagagaggagaaggaagggaataca
aatgttctgagactgttttgtttgagacaaaacaacctgaatgttgtatacgttatttca
EXON 5  171 bp
ggattttagctctttgaaacaagatgcttagaataagatgactttgcaatatttttggga
ctcgaaacctaacagataagaaaatttgctatatacagatgaatttctcttcatctctgt
gttataactttggcatcaagtaatgtttttcatcatttaattttcttctttgaacttcag
TATAAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAACCTGTCCATTTGGCATCGG
GATACATTTAAGCGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAAACATGGGAC
TGGGATAACAAACAGAATAAACAATTGAGATGGTACCCTCTGAAGCGGAAG
gtgagtccggaattttttgtttgtttatttggttggttgatgtggtacctagtgtatagg
aaaaagcttaattgcatttaattcagagtacagatctgtagtttgggagaattttaaact
agaggaaaaaaaagaaaggtaaaaaaggttattgggaacatgtttaaatcatttaacaca
EXON 6  79 bp
gttttcccaggtattaaggcaacagtctagttctgatgcagagagaaattttaatccaga
gcactcatgagtgacacatggtcccagaaatgggacagatatggttctgtaatgagacct
ataccaacaaacaggatgaaaagtttgtctcccacctgctgacatttcttcacttttcag
ACAGCACCAGTTGCCCTTGAAGCAGAAAACAGAGGTGAAATGAAACTAGCTCTCCAGTAT
GTCCCAGAGCCAGTCCCTG
gtatgtaatgactttctattcagatttatgtcctttccttatccctcccttctcacagta
tttactatgcgttttcaaaggtgaggccctaaagaaacttatcaagttagtaacgtatag
accaaatgagtctattcacagttgtaaataagaaaattctttttttgttattgtggcaaa
EXON 7  100 bp
ttcagtaaaaccagattatgaagacttagttaagactgtatagatttaatcagttcagat
gatatcatcaaatactagctagtatctccatgccagaacatttttaggctgacatctttg
gacgcagtattgccaagggagaactggcagtgaaaattttctcttctttttctattgtag
GTAAAAAGCTTCCTACAACTGGAGAAGTGCACATCTGGGTGAAGGAATGCCTTGATCTAC
CACTGCTAAGGGGAAGTCATCTAAATTCTTTTGTTAAATG
gtaatagtattgatgactctgtctgcaacagttctgtagcctggtctttgctggttagtt
tcggttctctatatctgtaatactgactcatcattcataatttaaatgaatttacttggg
ataatggagacatgaattggaggaatctatatcatgaactctcaaggcttcatttggctt
EXON 8  206 bp
gtcttttcagcatgatgtgttcctaccccctaccccactgtctgccaaaccaccaccacc
actatctctccacatcttttcctccattgtcaatctttaatagctgtgttgttatgtatt
gaaagcatgaatgttcactatcttactaaaatgctcccacaatcatgcctctttttgtag
TACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGACAAGAGCTGTAGGGAAAAC
CACCAACCCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGAAGATCTGAT
GGAAGCCTGTGTAGAGCTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGG
AGGTCTTCGTATTGGCTTTGGAACAG
gtactgtttgctacatttttaattctccatgagccaaatttttctagagatactagaggt
ttgtttgttgctttgcttcttcccagtgaaaaccgagatatcctgaaaacagatatctct
taagtatagtgaaataaatgagtaaagaaatgtcaggttgtatgccaagggctccagata
EXON 9  1057 bp
aacatgaagtcactcagacaattgaacagttcttccttatgttgagtctcacatctgccc
tcccagtgaagaaagctcctcctagcttccactggtggttataattagggaataactttc
cctctttcccctacccccaatgagctgtttctttctaaatgcaaagcttccttttttcag
GTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAGAGGAAGTTGCTCTCT
GGGAGAAGATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAGAATGC
TTTTGATTGCCAAGATTTCCAAATGAGCCCAAATTCCACTGGCTCCTCCACTGAAAACTA
CTAAACCGGTGGAATCTGATCTTGAAAATCTGAGTAGGTGGACAAATATCCTCACTTTCT
ATCTATTGCACCTAAGGAATACTACACAGCATGTAAAAGTCAATCTGCATGTGCTTCTTT
GATTACAAGGCCCAAGGGATTTAAATATAACAAAATGTGTAATTTGTGACTCTAATATTA
AATAAGATATTTGAACAAGCTAGGAAAATTGAATTTCTGCTGCTGCTTCAAAGAAAAAGC
TGCCCCAGAGCATTAAACATGGGGTATTGTTAAGAAGCAAAATGTTCTTGTTTGCCATCA
TGTGTTTCACACCACAATTCTGTGCCACAGTTAAGAGGGTCTGGTACCCTTGCAGGACCT
TTGTAGGTTGTGGGAAAAAGTCGCAGAAAGATACTCAAAGTGGAGCAGGGAATGGAGACA
GACATCAGTGATGATAAAAAAAAAAATGGACCTTAAGAAACTATTTACTCTGTAATCTCT
AATAAAATATGGAATTCCATATTAGGGCAATGAGACTGAAACTACTGGTGTTTTTCTGCC
TTGAGAAAACAAACAGTTAAAACAAGCCTCAAATGTATTTTAGTGCCACCCACTGGCCAT
AGGTACAATTCAGTTGTTGGCTTGTTTTGACTTAATTCTAAAATAGGTCTCAAGCCTGTA
TTTTTATGAGTTTATTTTTTTAAAACCCTGCATATATATGATTGTTTTTCTTATAACTTT
ACTATATGAAAGCAGCATAAGAGTAGTCACAAACATGTTTTGCAACAAAGTTTTAATTAG
AATGTAAGTTGCTCAGTTATACTGTTCTTCTTATGTATGTAAAATTTTCGTATTTTGTAA
AAACCCTTAGAATAAATTATCATTTGATTTAAATTGT
attagaaaattagcgtgacttctcattttaaataaaatattttaggaattctaaacatct
aaatttcctaacaaggctaatgaacttcttctgggctaatgtttctgcagtcttcactgc
aattctgggcatcatctcccctaagtgggcaactttggctatgttattaagagtaggatt