Gene RPS6KA4 Variant 1
DNA : 13.04 KbNT_033903
mRNA : 3118 bp NM_003942
CDS : 2319 bp NP_003933
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  120 bp
gccctgaggcctggcctgggggctcgggagacagggcggccccagccggccgcccaccgg
cagcccggcgctgtcacgttccagccgcctgactcaggccgcgcagggcggggagccggg
aggcggtgccggcgcccgcctcggccccggaggcggcaccaggaagcgcccgccccggcc
GGAGCCGCCATGTAACCGGCGCCGCCCGGAGCCCGAGCCGCGCGGGCCCCAGCGACCCGC
CCGCCATGGGGGACGAGGACGACGATGAGAGCTGCGCCGTGGAGCTGCGGATCACAGAAG

gtgggtgtggggcctgactgcggctgcccggggcaggccgggacgggtcatggaccggct
gggctcattcgccccctgtgcccacagccaacctgaccgggcacgaggagaaggtgagcg
tggagaacttcgagctgctcaaggtgctgggcacgggaggtgaggacccccatccaccgg
EXON 2  72 bp
ggagcccgagccgcgcgggccccagcgacccgcccgccatgggggacgaggacgacgatg
agagctgcgccgtggagctgcggatcacagaaggtgggtgtggggcctgactgcggctgc
ccggggcaggccgggacgggtcatggaccggctgggctcattcgccccctgtgcccacag
CCAACCTGACCGGGCACGAGGAGAAGGTGAGCGTGGAGAACTTCGAGCTGCTCAAGGTGC
TGGGCACGGGAG
gtgaggacccccatccaccgggcaggcgtcccaggcgcggtgcccctgacctcctgcctg
ctcactcttgggcctgggccaggccactgagcaggccccccaccctttcccggcacagcc
tgccttgcctgccccgccctgcctcgccagagtttgcatgcccacttccagggcactcca
EXON 3  219 bp
ctcccggggtgtgcacaccctttccttagaaggctctgccagctttttgcacacctgcct
gttgccccagctccttcgcctcatttgcacaccctcctgggttggcatcgcccccacccc
ccaagcctgcaccaatctcccgctcacagcccaccctccacccactcgctgctcccacag
CCTACGGCAAGGTGTTCCTGGTGCGGAAGGCGGGCGGGCACGACGCGGGGAAGCTGTACG
CCATGAAGGTGCTGCGCAAGGCGGCGCTGGTGCAGCGCGCCAAGACGCAAGAGCACACGC
GCACCGAGCGCTCGGTGCTGGAGCTGGTGCGCCAGGCGCCCTTCCTGGTCACGCTGCACT
ACGCTTTCCAGACGGATGCCAAGCTGCACCTCATCCTGG
gtgagcgcacaccacatcccaacggggttggggtggctgggggcaggcgaggccacctga
cggggctgcttcctgacttccactgcacctcccagactatgtgagcggcggggagatgtt
cacccacctctaccagcgccagtacttcaaggaggctgaggtgcgcgtgtatgggggtga
EXON 4  116 bp
gtgctggagctggtgcgccaggcgcccttcctggtcacgctgcactacgctttccagacg
gatgccaagctgcacctcatcctgggtgagcgcacaccacatcccaacggggttggggtg
gctgggggcaggcgaggccacctgacggggctgcttcctgacttccactgcacctcccag
ACTATGTGAGCGGCGGGGAGATGTTCACCCACCTCTACCAGCGCCAGTACTTCAAGGAGG
CTGAGGTGCGCGTGTATGGGGGTGAGATCGTGCTGGCCCTGGAACACCTGCACAAG
gtgggtgaagacctggccgcaggctgttgctatggaaactgggtctgtgccttggaagga
atctgcacgcagggcagcctcaggcttccccctgggcttcctggggggccagtggtgagc
tgggtgggaattggagctgcttcccctggaccccttgcaggaagcctcaacgttgcctgg
EXON 5  108 bp
ctccttctttgttttatatcttaaatggcctttcttattcagtggctctgccctggagac
cccctctacaggcagatgactttctctggggggtctccttatcctgagcagggccaggag
ctggaggagctggggagggtttcggggaggaagcctcagcacccctcttgctcctaccag
CTCGGCATCATTTACCGAGACCTGAAACTGGAGAATGTGCTGCTGGACTCCGAGGGCCAC
ATTGTCCTCACGGACTTCGGGCTGAGCAAGGAGTTCCTGACGGAGGAG
gtgagtggaggccacctctgcctgcagtgccccattcaatccttctccttcctgcctctt
cctgctctgggcctgcattctggggctgcagaagtgaatagctccaagaagtttccacag
ctcagctctccaacctcacaagttgagcgagtcttactctgggccttgtggggcactggg
EXON 6  81 bp
cttcctgcctcttcctgctctgggcctgcattctggggctgcagaagtgaatagctccaa
gaagtttccacagctcagctctccaacctcacaagttgagcgagtcttactctgggcctt
gtggggcactggggcacaggagaggtttcgacatctaagcaggacctcttgccctcccag
AAAGAGCGGACCTTCTCCTTCTGTGGCACCATCGAGTACATGGCCCCCGAAATCATCCGT
AGCAAGACGGGGCATGGCAAG
gtaggttggcagggaagtggggctgggggaggtggaaaggtggggtgtgaggcaggggag
atgcaggccctcaccccggctccacccggcaggctgtggactggtggagcctgggcatct
tgctcttcgagctgctgacgggggcctcgcccttcaccctggagggcgagaggaacacgc
EXON 7  104 bp
ctcccagaaagagcggaccttctccttctgtggcaccatcgagtacatggcccccgaaat
catccgtagcaagacggggcatggcaaggtaggttggcagggaagtggggctgggggagg
tggaaaggtggggtgtgaggcaggggagatgcaggccctcaccccggctccacccggcag
GCTGTGGACTGGTGGAGCCTGGGCATCTTGCTCTTCGAGCTGCTGACGGGGGCCTCGCCC
TTCACCCTGGAGGGCGAGAGGAACACGCAGGCTGAGGTGTCTCG
gtgagtagggctggacgtggagggcggccagagggctgcagggcctgcctgggcagggct
gtgggtggggggcttgctgcccctgacacccccccaatcctcccagacggatcctgaagt
gctcccctcccttcccccctcggatcgggcccgtggcgcaggacctgctgcagcggctgc
EXON 8  151 bp
ctcttcgagctgctgacgggggcctcgcccttcaccctggagggcgagaggaacacgcag
gctgaggtgtctcggtgagtagggctggacgtggagggcggccagagggctgcagggcct
gcctgggcagggctgtgggtggggggcttgctgcccctgacacccccccaatcctcccag
ACGGATCCTGAAGTGCTCCCCTCCCTTCCCCCCTCGGATCGGGCCCGTGGCGCAGGACCT
GCTGCAGCGGCTGCTTTGTAAGGATCCTAAGAAGCGATTGGGCGCGGGGCCCCAGGGGGC
ACAAGAAGTCCGGAACCATCCCTTCTTCCAG
gtgaggctgactcagggccccatacctcctggtgcatacccaggtggggctgctgttcca
ggttgaggttgtgcctggccagtttcactttatttggaaatccccccagagaaagaaagc
aagtgtgtgtcagctaggtttctcttcacatccatccccactgaaacttggcagatgtgt
EXON 9  165 bp
gaatagggattgtgttaccagagggagagagaagccagggaggcaggaggaacagctgcc
caccccaaatgccagatgggcccttgcctcatggaggaactgcccagtgagggtgggctg
agtggagggagtttctcgttcctggcctttgacacctgacctctgattcccttccctcag
GGCCTCGATTGGGTGGCTCTGGCTGCCAGGAAGATTCCAGCCCCATTCCGGCCCCAAATC
CGCTCAGAGCTGGATGTGGGCAACTTTGCGGAGGAATTCACTCGGCTGGAGCCTGTCTAC
TCACCCCCTGGCAGCCCCCCACCTGGGGACCCCCGAATCTTTCAG
gtgaggggaaactcatggaacccagatgcaggagagatgagatgttgctgtctgcctcag
ccctggctggcccgaggacactgcctaggccttgtgtcctgattgggactcagcgtctcc
cctagacgtcgccacttcagtgggacctagggttgtcagtcacagagaccacccaggcag
EXON 10  129 bp
tataaaaccaggtggaataaaaagtgtccacacatcctgtgtgtaccagaatgcaactgg
aacaccccccactgcccccttgtccagggtcttgcctttgcctggttccccaccagagtc
tcctcacccgcacccccaacccccatgcccatgcccattccccggactcccgccctgcag
GGATACTCCTTTGTGGCACCCTCCATTCTCTTTGACCACAACAACGCGGTGATGACCGAT
GGGCTGGAAGCGCCTGGTGCTGGAGACCGGCCAGGTCGGGCAGCGGTGGCCAGGAGCGCT
ATGATGCAG
gtgggctgggctgggctgggttggggggaaattggttttaggagaggcctaggcccgggg
actctaggcctagatccaactggcgcccgcagcgtgagctcagcaaggtcctaagcctct
ccgacatggggcgtggcggggccgcggggctaccaggtgggacctctgacgcgccgcctt
EXON 11  134 bp
gaaattggttttaggagaggcctaggcccggggactctaggcctagatccaactggcgcc
cgcagcgtgagctcagcaaggtcctaagcctctccgacatggggcgtggcggggccgcgg
ggctaccaggtgggacctctgacgcgccgccttcgccttcgccttcgccttcgcctccag
GACTCGCCCTTCTTCCAGCAGTACGAGCTGGACCTGCGGGAGCCTGCGCTGGGCCAGGGC
AGCTTTTCTGTGTGTCGCCGCTGCCGCCAGCGCCAGAGCGGCCAGGAGTTCGCAGTCAAG
ATCCTCAGTCGCAG
gtgggagggcccaggcgcgggcaggggtgggggtggcagagcgctgtcccgggggcgggg
ccgaagcgcggcgaccgtaactccttctgctccgtcccccaggctggaggcgaacacgca
gcgcgaagtggctgccctgcgcctgtgccagtcacaccccaacgtggtgaatctgcacga
EXON 12  94 bp
gggcagcttttctgtgtgtcgccgctgccgccagcgccagagcggccaggagttcgcagt
caagatcctcagtcgcaggtgggagggcccaggcgcgggcaggggtgggggtggcagagc
gctgtcccgggggcggggccgaagcgcggcgaccgtaactccttctgctccgtcccccag
GCTGGAGGCGAACACGCAGCGCGAAGTGGCTGCCCTGCGCCTGTGCCAGTCACACCCCAA
CGTGGTGAATCTGCACGAGGTGCATCACGACCAG
gtgatggcttccggccaggggagggcggagagaaaaggggcaggcggcggggcttggggg
cactatgggcgggatctaggggtgaattgggcggggcctagcgtttgattcggggcccaa
agggaccagggaggcgcagggagtggaatttgaggggagtagggcctgaggacgggaagg
EXON 13  174 bp
gggcgacaaagcgagactgtctccaaaaaagtaacaaagaaagaaagaaagaaaaaggac
tttgaggagggggttctcgaacattggcagggcccgaaggccgggggcggggcctgggtg
gtgggagggggcttgccgccgtgggtgggtgttgaccttggcccgccacgccgcccgcag
CTGCACACGTACCTGGTCCTGGAGCTGCTGCGGGGCGGGGAGCTGCTGGAGCACATCCGC
AAGAAGCGGCACTTCAGCGAGTCGGAAGCAAGCCAGATCCTGCGCAGCCTCGTGTCGGCC
GTGAGCTTCATGCACGAGGAGGCGGGCGTGGTGCACCGCGACCTCAAGCCGGAG
gtgggcgagctgcctcggcggcggggcggagcggtggcgccgggggctgcctctgaccac
taccccgccgccctcgcagaacatcctgtacgccgacgacacgcccggggccccggtgaa
aatcatcgacttcgggttcgcgcggttgcggccgcagagtcccggggtgcccatgcagac
EXON 14  195 bp
tcagcgagtcggaagcaagccagatcctgcgcagcctcgtgtcggccgtgagcttcatgc
acgaggaggcgggcgtggtgcaccgcgacctcaagccggaggtgggcgagctgcctcggc
ggcggggcggagcggtggcgccgggggctgcctctgaccactaccccgccgccctcgcag
AACATCCTGTACGCCGACGACACGCCCGGGGCCCCGGTGAAAATCATCGACTTCGGGTTC
GCGCGGTTGCGGCCGCAGAGTCCCGGGGTGCCCATGCAGACGCCCTGCTTCACGCTGCAG
TACGCTGCCCCCGAGCTGCTGGCGCAGCAGGGCTACGACGAGTCCTGCGACCTCTGGAGC
CTGGGCGTCATTCTG
gtatgggacgcggtccttgaggcggggtcagggtcgctcggacctggcgtcttcctgatg
tgcagcagcacgagggaggggacaggggtcatcttggtgggggcggctgggtttcgtccg
aagctgggatcggggtggttcaaatacagaggtggggtcgctctggtgctagagtcggag
EXON 15  160 bp
gtggggtcgctctggtgctagagtcggagcatccgggtattgggggttagaagtcagggt
tcaccacgcgtgggtctcaggagtgcccctagtggggagggtgagtggttctgtgggagc
ggaggggtcagcctcggcaccccagcctgggccggcctcaccttcccctcaccctcctag
TACATGATGCTGTCGGGGCAGGTCCCCTTCCAGGGGGCCTCTGGCCAGGGCGGGCAGAGC
CAGGCGGCCGAGATCATGTGCAAAATCCGCGAGGGGCGCTTCTCCCTTGACGGGGAGGCC
TGGCAGGGTGTATCCGAGGAAGCCAAGGAGCTGGTCCGAG
gtgcggagctggaggtcatagaccatggttggggagggggacgctgggacagggatggtc
actgggccaggtgtcctggttggggatgggtaggggaggagagtggggctgttacgatct
ctttggggctcagcctttacgccaggctcctccccacacttccttgccccgcctccaggg
EXON 16  164 bp
aggtgcggagctggaggtcatagaccatggttggggagggggacgctgggacagggatgg
tcactgggccaggtgtcctggttggggatgggtaggggaggagagtggggctgttacgat
ctctttggggctcagcctttacgccaggctcctccccacacttccttgccccgcctccag
GGCTCCTGACCGTGGACCCCGCCAAGCGGCTGAAGCTCGAGGGACTGCGGGGCAGCTCGT
GGCTGCAGGACGGCAGCGCGCGCTCCTCGCCCCCGCTCCGGACGCCCGACGTGCTCGAGT
CCTCTGGGCCCGCAGTGCGCTCGGGTCTCAACGCCACCTTCATG
gtaaggggcagggtctgttgaagggaaggggtgggcgaagcctcgagaggtggggtctgg
ggaggcccggccatcggagcacagaaaggcgaggtgaggccgggcgcggtggctcacgcc
tgtaatcccagcgctttgggaggccgaggcgggcggatcacgaggtcaggggttcgagac
EXON 17  932 bp
aaaaaaaaaaaaaaaaaaaaaaaagggaggtgaaccgaatccggtggtcggtctggaggc
caaggccctgtcggccttgacctaggcggctggaggcaaggtctgggaatggaggtcaaa
ctagatctggaagccggggtcaggcgggggtgggggcactcaccctttcctttctgccag
GCATTCAACCGGGGCAAGCGGGAGGGCTTCTTCCTGAAGAGCGTGGAGAATGCACCCCTG
GCCAAGCGGCGGAAGCAGAAGCTGCGGAGCGCCACCGCCTCCCGCCGGGGCTCCCCTGCA
CCAGCCAACCCGGGCCGAGCCCCCGTCGCCTCCAAAGGGGCCCCCCGCCGAGCCAACGGC
CCCCTGCCCCCCTCCTAATCCCCACCACTGTGACCCCCTTCCCTCATAGGGGCTGTGACC
TGGGAGCCCGGCTCACTCCCGGAGGCCTCTGCCTGCGGCTGACCTGATCCCCAAGGGACT
GTCCTTTCCTCTCCTACCCCACCCCACTCCCAGACAGAGCAGAAGTATTTTTATAAGCAG
AGAATTTTTTATGTCTTACCAGATAGAGTTGCAGGGAAGGGGGGGCCTGCTGGGGAGTGG
GGTTTGGGGGGCCCTCTCCCAGGACACTGCCTCTTCTGGGCAGAAGGCCCCTCCAGGGGG
ACTGCTCCAACAGGAAAGAGCCCCTCCCCCACTTCTAAGCACTGAGTTAGGAGTGCTAAC
TCCTAAACTGGGACCCCCTACCCTGTTCTCCCCTGAGGCCCCGTTCCTGGGAGGGGCACC
CCTCAACTGTCACTTTATGGACTGTCTGTGCAATTACGTCCACCAAAGACCCGTGTTGGG
GGTACTGAAGGAGAGGCCCTGGGGGACCCTCTGAAGCATTTCTGCCTCACTTTATGTCAT
CTGCTTCTCCCCTGTTGGGGCTAAGGAAGGAGATAGGTGGCTCCTAAAAGAGGAGGCCAT
CTTCTCACCCACCCCTTCCTCTTTGGCACAGCTACTCCTGGCTGGGGGTGGGGCCTTGGG
GGTCTGGGCTGGGCATCCATGGTCACTGCCTCAGCCCAGCCAGGCTGTGCCTTTGACTTT
AAAATAAAAGTCCACCCAGTGCTGTGTGTGGC
atctgcgtgtcctcgttcgtgttgtgggtgtctagagcagagattctgggcagacaggct
gctagcccgtggagtttggaacctcagtggggagggacaggcagactcttctgggcaaga
agatattctttgttccttgacttttgctatgagcaggagggcgcaactctcatcctgggt