Gene RBM14 Variant 1
DNA : 10.70 KbNT_033903
mRNA : 2764 bp NM_006328
CDS : 2010 bp NP_006319
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  416 bp
tccctttcccaccccctcagctaacgagcgggctctaggccctctgggattggctgtgcc
tgagcacatcttccctcagcgtttctgattggtcgctggacgcgcgggatgcgagtcccc
attggctaggccagggcgcctgcgcggcggggttctcggtcgccagccattcctgaggag
GACTGCCGGTCGTTCGGACGTCTTGCCTGTCGCTGGAGGAGAGGTCCGGGCTCTCCAGGA
AGGTGGCTGCGGCGACAAAATGAAGATATTCGTGGGCAACGTCGACGGGGCGGATACGAC
TCCGGAGGAGCTGGCAGCCCTCTTTGCGCCCTACGGCACGGTCATGAGCTGCGCCGTCAT
GAAACAGTTCGCCTTCGTGCACATGCGCGAGAACGCGGGCGCGCTGCGCGCCATCGAAGC
CCTGCACGGCCACGAGCTGCGGCCGGGGCGCGCGCTCGTGGTGGAGATGTCGCGCCCAAG
GCCTCTTAATACTTGGAAGATTTTCGTGGGCAATGTGTCGGCTGCATGCACGAGCCAGGA
ACTGCGCAGCCTCTTCGAGCGCCGCGGACGCGTCATCGAGTGTGACGTGGTGAAAG
gtaacgcggaggcgcgctcgggggcgggggcgcgctcggggcactctgcctgttagccac
gccccttacccgggggtcggtcactgcgcggttgggaggggtggggaagtgcgcgggagc
aggtcggaggtgttgggggcgcgttgggtagagccaccctcctcccctgcggtccaggaa
EXON 2  1465 bp
gacagtcagaagctttgttatatgggagctacattttatgacatactcctggagaggagg
gtttggaggccttggaggtagctggcaacagctgggtgctgttgtgtgtccaatttggga
cccatcaggtagcatgccctgcccccctaattgctaaccctctgtctgctgctttatcag
ACTACGCGTTTGTTCACATGGAGAAGGAAGCAGATGCCAAAGCCGCAATCGCGCAGCTCA
ACGGCAAAGAAGTGAAGGGCAAGCGCATCAACGTGGAACTCTCCACCAAGGGTCAGAAGA
AGGGGCCTGGCCTGGCTGTCCAGTCTGGGGACAAGACCAAGAAACCAGGGGCTGGGGATA
CGGCCTTCCCTGGAACTGGTGGCTTCTCTGCCACCTTCGACTACCAGCAGGCTTTTGGCA
ACAGCACTGGTGGCTTTGATGGGCAAGCCCGTCAGCCCACACCACCCTTCTTTGGTCGCG
ACCGCAGCCCTCTGCGCCGTTCACCTCCCCGAGCCTCTTATGTGGCTCCTCTGACGGCCC
AGCCAGCTACCTACCGGGCCCAGCCGTCCGTGTCACTGGGAGCTGCCTACAGGGCCCAGC
CTTCTGCCTCTTTGGGTGTTGGCTATCGGACTCAGCCCATGACAGCCCAGGCAGCCTCTT
ACCGCGCTCAGCCCTCTGTCTCCCTTGGGGCACCATACAGGGGCCAGCTGGCTAGTCCTA
GCTCCCAGTCTGCTGCAGCTTCTTCACTCGGCCCATATGGTGGAGCCCAGCCCTCAGCCT
CGGCCCTTTCCTCCTATGGGGGTCAGGCAGCTGCAGCTTCTTCGCTCAACTCCTATGGGG
CTCAGGGTTCCTCCCTTGCCTCCTATGGTAACCAGCCATCCTCTTACGGCGCCCAGGCTG
CCTCTTCCTATGGGGTTCGTGCAGCTGCTTCTTCCTACAACACCCAGGGAGCAGCTTCCT
CCTTAGGCTCCTACGGGGCTCAGGCAGCCTCCTATGGGGCCCAGTCTGCAGCCTCCTCAC
TAGCTTATGGAGCCCAGGCAGCTTCATATAATGCCCAGCCCTCGGCCTCTTACAATGCCC
AGTCTGCCCCATATGCTGCACAGCAGGCTGCTTCCTACTCTTCCCAACCTGCTGCCTATG
TGGCACAGCCAGCCACAGCTGCTGCCTATGCCAGCCAGCCAGCAGCCTACGCCGCACAAG
CCACTACCCCAATGGCTGGCTCCTATGGGGCCCAGCCGGTTGTGCAGACCCAGCTGAATA
GTTACGGGGCCCAAGCATCAATGGGCCTTTCAGGCTCCTATGGGGCTCAGTCGGCTGCTG
CGGCCACTGGCTCCTATGGTGCCGCAGCAGCCTACGGGGCCCAACCTTCTGCCACCCTGG
CAGCTCCTTACCGCACTCAGTCATCAGCCTCATTGGCTGCTTCCTATGCTGCCCAGCAGC
ATCCCCAGGCTGCTGCCTCCTACCGCGGCCAGCCAGGCAATGCCTACGATGGGGCAGGTC
AGCCGTCTGCAGCCTACCTGTCCATGTCCCAGGGGGCCGTTGCCAACGCCAACAGCACCC
CGCCGCCCTATGAGCGTACCCGCCTCTCCCCACCCCGGGCCAGCTACGACGATCCCTACA
AAAAGGCTGTCGCCATGTCGAAAAG
gtactgtatgcccccccgcctctgcccccagctggggcttagggcaaggggctgaggttg
gcatgggagggaaactggaggcatcggcccctccctcggtcttctcttctctatttttgt
gggatgtccagaggccgaggggagcagtgtctatgaactttcctggtcaccagggttcag
EXON 3  883 bp
gaagccaggcttgatttttttggcctggatagggtgatgagccttctgacaaaaggagac
caatctcttggagaccactgtgatcacaccctccctgtccccattggcatctccccaatg
cccacctggagtcctcccctcaattgtctcattcaccaactgtcttcttctctcgactag
GTATGGTTCCGACCGGCGTTTAGCCGAGCTCTCTGATTACCGCCGTTTATCAGAGTCGCA
GCTTTCGTTCCGCCGCTCGCCGACAAAGTCCTCGCTGGATTACCGTCGCCTGCCCGATGC
CCATTCCGATTACGCACGCTATTCGGGCTCCTATAATGATTACCTGCGGGCGGCTCAGAT
GCACTCTGGCTACCAGCGCCGCATGTAGGGCCATCCTGGGATGGGGCACCACAGGGAGGG
AGGGAGAAAAGAGGTGGGTAGGGTTACAGATCCAGGTTATAACTACTCTGGCCCATACCT
TTCCTGGTTGTGGTTTTTCATGCCCTCTACCATGTGGGCCTTCCCCAGGAGATGATCCTG
TTAAGTGTTCGGCAGTAACCTACTTTGTTCCTTCGCCTCAGCAGCAAATCTTGCTACTGG
CTCTAGATCTGCGGTTTCCCCTCTACCCTGCCTCCCGTCTCCCCAGAATGGGAATTTCTT
TTATGTTTTTATTTTTTTCCTGGCTCCCTTTTATTTTTGTGCGCGATATTTAAGGTCGTC
TGGATGGGGAAGCAACCTGCAGCTGAGGTCGCCGGCGCCTTTTTCTTTTTAGATGGGAAG
GAGGCCAGGAAAGGGTCAGCTTAACCATTTCCTATGTGCCAAGCTGTGCCAGCAGTCCAG
GGTACCCTGACTGTCCCTCTGTAGACTGTTGAGACTGAGTTCCTGTTGGGACAGTCAGTT
GGTATGTATCCAAGTCCCTGCTGACCACTAATGTTCTAGCTGATGGTGAGCGGCACAGTC
CCACTTCCCCATCTCCCCAAGTAGGTGGTGTTAGAAAACCTTAATTTTTTTTCCCTTTTG
TATGGACTACAAATAAAACTTGGGGCAATTTGCAGTTTGGAAA
cctggttgtcattgtcttgattgcattcagtgtcaaaggagccaatttgacatccaggaa
gacatgatagctaaagggaaggcagtcagagaacccaggactggtgaggaaaggggtttg
aatgtcggaattagaaggattgccctgtggcccagaaggatttagctcatcgtcgtcctg