Gene RAD9A Variant 1
DNA : 6.46 KbNT_033903
mRNA : 2121 bp NM_004584
CDS : 1176 bp NP_004575
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  127 bp
gggcacggaaggccgaggcgtgccgggggagccaggagcagctggctggcgggcgccgcg
ggcctccccggtcacgtgacaccccggacaacgtgcgccgtcacgtgacggcagagcctg
tgagcgtttttctcacgtgacggaggcgcctgcacgtggaccaatggggaggcgggggcg
GGGCCGGCAGGGGCGGTGCGCGGGAAGGGACCCCGGACCCGGAGGTCGCGGAGAGCTGGG
CAGTGTTGGCCGCTGGCGGAGCGCTGGGGCAGCATGAAGTGCCTGGTCACGGGCGGCAAC
GTGAAGG
gtgagtgcaggtcggcctggcagcggcggtgcagcagccgcggagccgccagcctaaccc
ccttccgctcttctccccgcagtgctcggcaaggccgtccactccctgtcccgcatcggg
gacgagctctacctggaacccttggaggacggggtgaggggctagggtgtggggggcggg
EXON 2  71 bp
accccggacccggaggtcgcggagagctgggcagtgttggccgctggcggagcgctgggg
cagcatgaagtgcctggtcacgggcggcaacgtgaagggtgagtgcaggtcggcctggca
gcggcggtgcagcagccgcggagccgccagcctaacccccttccgctcttctccccgcag
TGCTCGGCAAGGCCGTCCACTCCCTGTCCCGCATCGGGGACGAGCTCTACCTGGAACCCT
TGGAGGACGGG
gtgaggggctagggtgtggggggcgggtgggactccagccgggagcgggtaacccggact
agagtctcgcccccactaggcgggatgaccgctggcagatttgtcggcaaagtttcagtt
tcttagtctggcggctgtcatcttcccaggccggtgtgtgaattgaggaaagctgtcctg
EXON 3  129 bp
tcctctgcggcagcagcgccggggccgactctgaaggcttccatggggaaaggagggttt
ttcagcaggtggtggcggagcgggaggacgatagggcaagtgtgtgagcagaagcagcca
gagggctgggtctgtggctgccccctgaccacgtccctctccctgctcttcgtggcccag
CTCTCCCTCCGGACGGTGAACTCCTCCCGCTCTGCCTATGCCTGCTTTCTCTTTGCCCCG
CTCTTCTTCCAGCAATACCAGGCAGCCACCCCTGGTCAGGACCTGCTGCGCTGTAAGATC
CTGATGAAG
gtgaggcccttccctcagcagtggcactactccaccccaggaatctccaccagctgtgcc
tctgccctggggtactcagtagatgctaagtggggagagagacacgtgcaagcccaatcc
atgcaaaacacagggagggccatggtaaaagcatcacagcggggacctgagagggtggtg
EXON 4  115 bp
ggcattccaagcataaggaagagcatgaatgaggcctagaaggatgccagtgcccgaggt
gacgtgggagcccttttcccagagttacatgctgggcccatgatgggtgtgggcctgcat
gggacaggagagcttgttgcagagatgtgatgctaggctgaggtgtcttatcccatgcag
TCTTTCCTGTCTGTCTTCCGCTCACTGGCGATGCTGGAGAAGACGGTGGAAAAATGCTGC
ATCTCCCTGAATGGCCGGAGCAGCCGCCTGGTGGTCCAGCTGCATTGCAAGTTCG
gtgagtgggcagccggccagccaaggggtgcctcagcagggaggtcggcgaggcccactg
agaccctatcgcccatccaggggtgcggaagactcacaacctgtccttccaggactgtga
gtccctgcaggccgtcttcgacccagcctcgtgcccccacatgctccgcgccccagcacg
EXON 5  100 bp
ttccgctcactggcgatgctggagaagacggtggaaaaatgctgcatctccctgaatggc
cggagcagccgcctggtggtccagctgcattgcaagttcggtgagtgggcagccggccag
ccaaggggtgcctcagcagggaggtcggcgaggcccactgagaccctatcgcccatccag
GGGTGCGGAAGACTCACAACCTGTCCTTCCAGGACTGTGAGTCCCTGCAGGCCGTCTTCG
ACCCAGCCTCGTGCCCCCACATGCTCCGCGCCCCAGCACG
gtgagcacacccctgccctcagctcagccccgggtctctctcttccttctttggggcccc
aaggggttgattttagaaggtacctctttcattttccctacagagtttctgtgaacctca
aagacatcccatggcccgctatgtgctcaggtccttacctggctctttaaaggcagacgg
EXON 6  110 bp
caggtttgagcaaccactgcaaccagtcccctccctgccaccttctctgggcctcatcca
cggtgcgctaggcctgcgcacatccgtgcgtgtgcatgtgtcacccccacctcaggtcct
ccgagagcaaagccctgggcagggccaggcatttcgggtaatgctccaccctgttcacag
GGTTCTGGGGGAGGCTGTTCTGCCCTTCTCTCCTGCACTGGCTGAAGTGACGCTGGGCAT
TGGCCGTGGCCGCAGGGTCATCCTGCGCAGCTACCACGAGGAGGAGGCAG
gtgagggggctggacgtggcctgggacagcagagtggcaggtgggagaggggcggggccc
aggttactcctgttcttccccaacagacagcactgccaaagccatggtgactgagatgtg
ccttggagaggaggatttccagcagctgcaggcccaggaaggggtggccatcactttctg
EXON 7  110 bp
gttctgcccttctctcctgcactggctgaagtgacgctgggcattggccgtggccgcagg
gtcatcctgcgcagctaccacgaggaggaggcaggtgagggggctggacgtggcctggga
cagcagagtggcaggtgggagaggggcggggcccaggttactcctgttcttccccaacag
ACAGCACTGCCAAAGCCATGGTGACTGAGATGTGCCTTGGAGAGGAGGATTTCCAGCAGC
TGCAGGCCCAGGAAGGGGTGGCCATCACTTTCTGCCTCAAGGAATTCCGG
gtgaggttcctcccaggcgctcgccgtcctgtcctccctgcccagctcagcccagcccgg
ggcctcacctgctacctctttcctcccaggggctcctgagctttgcagagtcagcaaact
tgaatcttagcattcattttgatgctccaggcaggtagttcccagccttgggacagggaa
EXON 8  65 bp
ggtgactgagatgtgccttggagaggaggatttccagcagctgcaggcccaggaaggggt
ggccatcactttctgcctcaaggaattccgggtgaggttcctcccaggcgctcgccgtcc
tgtcctccctgcccagctcagcccagcccggggcctcacctgctacctctttcctcccag
GGGCTCCTGAGCTTTGCAGAGTCAGCAAACTTGAATCTTAGCATTCATTTTGATGCTCCA
GGCAG
gtagttcccagccttgggacagggaagggctctgggatggcaggagctgaatgggatgac
ctagcttgggccccctcccctgcccaggcccgccatcttcaccatcaaggactctttgct
ggacggccactttgtcttggccacactctcagacaccgactcgcactcccaggacctggg
EXON 9  138 bp
gcctcacctgctacctctttcctcccaggggctcctgagctttgcagagtcagcaaactt
gaatcttagcattcattttgatgctccaggcaggtagttcccagccttgggacagggaag
ggctctgggatggcaggagctgaatgggatgacctagcttgggccccctcccctgcccag
GCCCGCCATCTTCACCATCAAGGACTCTTTGCTGGACGGCCACTTTGTCTTGGCCACACT
CTCAGACACCGACTCGCACTCCCAGGACCTGGGCTCCCCAGAGCGTCACCAGCCAGTGCC
TCAGCTCCAGGCTCACAG
gtgagggcacctccccccaactcctcctctctccatgtctgtgcactccagcctgagact
gcaactcctagcttctgcacctccccgcaatgtgttctctcccgccccttctctttctat
caggccccagcccctaaccctatagtgctcacagctgccagccctgcagactcagccttc
EXON 10  208 bp
ccccctccaggaagtcaccacttaacccctgcatcctctcctctccagccaaatcaggaa
gtcataaaaccaagagatctccagtggtcgggggccccagagctcccttcgagccctcca
aggtggggccctgcctctgctcccccagtcccctccctgatactccgattctgcctacag
CACACCCCACCCGGACGACTTTGCCAATGACGACATTGACTCTTACATGATCGCCATGGA
AACCACTATAGGCAATGAGGGCTCGCGGGTGCTGCCCTCCATTTCCCTTTCACCTGGCCC
CCAGCCCCCCAAGAGCCCCGGTCCCCACTCCGAGGAGGAAGATGAGGCTGAGCCCAGTAC
AGTGCCTGGGACTCCCCCACCCAAGAAG
gtagggactggaggtggaggcaggggtgggaggtagggaagggagcagcctccagaactc
acttgttctctttccagttccgctcactgttcttcggctccatcctggcccctgtacgct
ccccccagggccccagccctgtgctggcggaagacagtgagggtgaaggctgaaccaaga
EXON 11  948 bp
cctttcacctggcccccagccccccaagagccccggtccccactccgaggaggaagatga
ggctgagcccagtacagtgcctgggactcccccacccaagaaggtagggactggaggtgg
aggcaggggtgggaggtagggaagggagcagcctccagaactcacttgttctctttccag
TTCCGCTCACTGTTCTTCGGCTCCATCCTGGCCCCTGTACGCTCCCCCCAGGGCCCCAGC
CCTGTGCTGGCGGAAGACAGTGAGGGTGAAGGCTGAACCAAGAACCTGAAGCCTGTACCC
AGAGGCCTTGGACTAGACGAAGCCCCAGCCAGTGGCAGAACTGGGTCTCTCAGCCCTGGG
GATCAGAAAGGTGGGCTTGCTGGAGCTGAGCTGTTTCACTGCCTCTCGCAGGCCCCAGCT
GGCTGTCACTGTAAAGCTGTCCCACAGCGGTCGGGCCTGGGCCGTTATCTCCCCACAACC
CCCAGCCAATCAGGACTTTCCAGACTTGGCCCTGAACTACTGACGTTCCTACCTCTTATT
TCTCATTGAGCCTCAGGCTATACTCCAGCTGGCCAAGGCTGGAAACCTGTCTCCCTCAGG
CTCACCTTCCTAAGGAAAATGTCATAGTAGGTGCTGCTGGCCCCTGGTGATCCAGCTTCT
CTGCCAATCATGACCTGTTCCTTCCTGAAGTCCTGGGCATGCATCTGGGACCCCCGTGGA
GCTGACAAGTTTTCCTTGCTTTCCTGATACTCTTTGGCGCTGACTTGGAATTCTAAGAGC
CTTGGACCCGAGTGTGTGGCTAGGGTTGCCCTGGCTGGGGCCCGGTGCCGAGACTCCCAA
GCGGCTCTGTGCAGAAGAGCTGCCAGGCAGTGTCTTAGATGTGAGACGGAGGCCATGGCG
AGAATCCAGCTTTGACCTTTATTCAAGAGACCAGATGGGTTGCCCCAGGATCCGGCTGCC
AGCCCTGAGGCCAAGCACGGCTGGAGACCCACGACCTGGCCTGCCGTTGCCCTGAGCTGC
AGCCTCGGCCCCAGGATCCTGCTCACAGTCACCGCAGGTGCAGGCAGGAAGCAGCCCTGG
GGGACTGGACGCTGCTATTGATTCATTAAAAAAAGAAAAGAAAAATAC
accaaggctccatgttccccgtgacaggtgggcctgaggggtcggggtgaccccccccca
gcatggcagcatgatttctgtacaatcaatccatcatctggggcacagggtggtgtgcgg
gggctatttcttggctttggcggaattgcggggtggggtgatgggtcggcctccagggtt