Gene RAB6A Variant 1
DNA : 85.16 KbNT_033927
mRNA : 3048 bp NM_002869
CDS : 627 bp NP_002860
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  487 bp
tcgccgccgtgcgggaggagccggtagagctgtccaaaccaggaaggcgatggcgatggc
ggtggcgcgcacgcatgcacgcacgcacgcacgccagcggccggcggggccgcaggctcg
cgcccgggctcgccccgcgccgctccagaggctcgcgcactcagcaggttgggctgcggc
GGCGGCGGCAGCTGTGGAAGCTCAGGCGCTGCGCGTGAGAGGTCCCAGATACGTCTGCGG
TTCCGGCTCCGCCACCCTCAGCTTCTCTTCCCCAGGTCTGGGAGCCGAGTGCGGAAGGAG
GGAACGGCCCTAGCTTTGGGAAGCCAGAGGACACCCCTGGCTCCTGCCGACACCGCCCTC
CTTCCCTTCCCAGCCGCGGGCCTCGCTCGGTGCTAGGCTACTCTGCCGGGAGGCGGCGGC
GGCTGCCAGTCTGTGGAGAGTCCTGCTGCCCTCCAGCCGGGCTCCTCCACCGGGCCTTGC
AGGGGCCGAGAGAGCTCGGTGCCCGCCCTTCCGCTCGCCTTTTTCGTCAGCTGGCTGGAG
CAGCATCGGTCCGGGAGGTCTCTAGGCTGAGGCGGCGGCCGCTCCTCTAGTTCCACAATG
TCCACGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTCAAGCTGGTGTTCCTGGGGGAG
CAAAGCG
gtgagtgcgtggctcccctactcctggcagctggccgcagcgtccccgcaccgcccccgg
tgcggcccttccgtccgcggaggctccctgcccgcctcgcgtccgcgctcgttgccaccg
cagcccttcccgatgtgccccccggtgccactggctcttcgccagtggccgagtttttac
EXON 2  59 bp
ttgtctgtgtttggagaaagtcattttgacaatcttggggctatatgggttttaattatt
cttagtagaaccattgcaggtatttcccattgactttaattgcagttctctgtagaaaaa
ttttctgagaacccaatgtaatgtgttcactgagcaaatctttttttcgtttcatttcag
TTGGAAAGACATCTTTGATCACCAGATTCATGTATGACAGTTTTGACAACACCTATCAG
gtattttgtttttgccaatttatttgttgtctattttttgttacaagtaatattcaagat
atttttaaaaaattatttacttgcagttgtggatgtaaaagtactttctataatctgtaa
aatgctgtataaatacaatgtgtaaatgattttgtccagtcctaggataaacttttatca
EXON 3  54 bp
tgaatacatgaaaatcattatcactggaaattttgtttgtccttaattgtccttaattga
ctatgttgtattgatttgtttattcattatttcttccacaatcatgaatcccatttgaat
cctaaactgctggccaccattaaacttattatttgttaacttctttgttttgttttacag
GCAACAATTGGCATTGACTTTTTATCAAAAACTATGTACTTGGAGGATCGAACA
gtgagtaatattttcagtgtgcaattttctgcaacattccaggttagaaaactgcaatca
aagttatcaatgattgtcaccataagaagtacttagcaaagttaccaaagatagtttaca
gttgttgagaaaaactcttattaccgagtgagtagtacttggcagtcatcttgatttgga
EXON 4  106 bp
ttctcccttttgaaaaaggagttttgtgttattttcattcctcactccctgcaacctctt
gcatgagtcttctttctacttccttcccaccctctcccttttacaaaaaacattgtttct
tttttctttttagtattagtttggtttttttttttttatttattttttcccatctcacag
ATCAGGCTTCAGCTGTGGGATACTGCGGGTCAGGAACGTTTCCGTAGCCTCATTCCCAGT
TACATCCGTGATTCTGCTGCAGCTGTAGTAGTTTACGATATCACAA
gtaggtatattgcaacgggttgacctttcttatttttcttgcttgtttgactgattttgt
tgttaggtacgattgcaattatgggacacagcaggtcaagagcggttcaggagcttgatt
cctagctacattcgtgactccactgtggcagttgttgtttatgatatcacaagtgagtgg
EXON 5  112 bp
gtttaaattgctgacagttgtaatcagataaaatggagttatgttgcaggcacattaaaa
gtggggtactaatgtgccagcccccttccaacttccagggcttttttggagggaggtgcc
caccacctggggaggcatttttcagcaacactaatctctctgtctaccctcctatactag
ATGTTAACTCATTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAA
GTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAG
gtatggagttattttatatgtgtgtaatgtttgatttctgtgatgcagccttttattttt
gttcactgagaaattgttttgaaaggagacatgcttaatccttaagtttacgtcctcccc
tgcttttctttagcatgggaacctcaaatataaatgtaaatattaaacagccagtcctta
EXON 6  94 bp
agtatacacacacagaaacacacaaatttcaagagtgtggcagattaatgaatttttaaa
ctaatgtgacctgtataaccagtccttatatcaaggaaagttattttcagagctttcttt
ataatctttataatactgcctcatgtctcaaaagtaagaagtttgtttgtttctttacag
GCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGA
AACTAGTGCAAAAGCTGGATACAATGTAAAGCAG
gtaagttgagttgaggttaccaaattgaaaaaatatgaaataattgtgtgagtattctat
tctctggtgtataggtttccttccacctggcaagagcaggccttacaaactagcagtata
ttttcaaacagtgaaaaatataaatgtggcatagtttttggaaaaagagaaaagacttgc
EXON 7  67 bp
ctggtctcaaactcctgacctcaagtgatctgcccacctcgggtgggtcccaaagtgctg
ggattacaggtgtgagccactgcgcccagcattagacagctcactgtacagtgatcataa
acctcagtaccctttgctaaatgttccctctcagttatcacttttctctctttcccacag
CTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGA
GAAGATA
gtatcctttttatttcattggaaatttttcattattaacactagtctttagagccctgct
tgcttggctaaagaatattgtgccattgccttttacaaccaggaactgatgacttaaagg
catagaaattcatttgttttctatagcaaatgaggtctggttatccaagtgcaccctttg
EXON 8  2069 bp
gtagatataaacaagtttattccatttgagcaccttatatggtgaggcggctatgtagaa
aatagtgagtgtgtaggctctgaagacagataggaatataagggccatcccagaaatgct
agtgtttggaagaattgaaattgtactttcccatttatggcttcttaacttttgtttcag
TGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCT
GCTAATCTCCCATGTCATCTTCAACCTTCTTCAGAAGCTCACTGCTTTGGCCCCCTTACT
CTTTCATTGACTGCAGTGTGAATATTGGCTTGAACCTTTTCCCTTCAGTAATAACGTATT
GCAATTCATCATTGCTGCCTGTCTCGTGGAGATGATCTATTAGCTTCACAAGCACAACAA
AAGTCAGTGTCTTCATTATTTATATTTTACAAAAAGCCAAAATATTTCAGCATATTCCAG
TGATAACTTTAAAAATTAGATACATTTTCTTAACATTTTTTTCTTTTTTAATGTTATGAT
AATGTACTTCAAAATGATGGAAATCTCAACAGTATGAGTATGGCTTGGTTAACGAGCGGT
ATGTTCACAGCCTACTTTATCTCTCCTTGCTTTTCTCACCTCTCACTTACCCCCATTCCC
TATTACCCTATTCTTACCTAGCCTCCCCCGACTTCCTCAAAACAAACAAGAGATGGCAAA
GCAGCAGTTCTACCAAGCCCATTGGAATTATCCTTTAATTTTACAGATACCACTTGCTGT
AGGCTACGGACCAAGATGTCCAAAATTATTCTTGAGCACTGATATAAATTACGGTCTTCT
TTGAGGTCAAAATTCAGCCATCATGGTAGGCAGTGCTTGAATGAGAAAAGGCTCCTGGTG
CATCTTCAAAATGAGTCCTAAAGAACATACTGAGTACTTAGAAGTAGAAGAACATAAGAT
GTATTTCTGACTAAAACAAATGGCTCTTTCACATGTGCTTTATTAGACTCTGGGAGAGAA
AATTAACCAAGTGCTTCAGAACAGGTTTTTAGTATTTAATTCTTCACGGTAAGAAAATGA
AGTTCTAATGAACTGTTTCTCCCAAGGTTTTAAAATTGTCAAGAGTTATTCTGTTTGTTT
AAAAAATAAGAAACCTCTTTAAGCAATAGATTTTGCTTGGGTTTTCTTTTTTAAAAACAT
AATACTGTGCAGGCAAGGCACTGTAAAAGTTTTAATTCCTTCCAGAAGAACCAGTGGAAG
AATTTAAATTTGGCGCTACGATCAAAACTACTGAATTAGTAGAAATAATGATGTCTAAAG
CTTACCAACAAAAGAACCCTCAGCAGAATAACAAAAACTTTGCTCAGGACATTTGAGGTC
AAATTGAAGACGGAAACCGGAAACCGTTTTCTTGTAAGCCCCTAGAGGCAGATCAGGTAA
AGCATACATAGTAGAGGGAAAGGAGAGAATGGAAATAAAACTCAATATTATGCAGATTTA
TGCCTTATTTTTTAGCATTTTTTAAGGTTGGGTCTTTCAGGCTGGTTTTGGTTTGTATTA
GATCTGTATAGTTTAATTAACTGGTGATTTAGTTTTATATTTAAGCTACAATTAATCTTT
TTTCTTTGGTGATATTTATTTCTTTGCCTTTTTTTTTTTTAACAACTTTCAATCTTCAGA
TGTTTCGTTGAATCTATTTAGAGCTTCACCATGGCAATATGTATTTCCCTTAAAACACTG
CAAACAAATATACTAGGAGTGTGCCCTTTTAATCTTTACTAGTTATTGTGAGATTGCTGT
GTAAGCTAATAAACACATTTGTAAATACATTGTTTGCAGGACGAAAACTTCTGAGTTACA
GCTCAGGAAAAGCCTGCTGAATTTATGTTGTAAGCATTACTTAACACAGTATAAAGATGA
AAAGACAACAAAAATATCTTCATACTTCCTCATCCCCTCATTGGAACAAAACCTTAAACT
GGGAGAACCTTAGTCCCCTCTCTTTCCTCTTCCTCCTCCACTTCCCACTTATTGTCACCT
TGTAATATTCAGAGAGCACTTGGATTATGGATCTGAATAGAGAAATGCTTACAGATAATC
ATTAGCCCACATACCAGTAACTTATACTTAAAGATGGGATGGAGTTGTAAAGTGCTTTTA
TAATACAATATAATTGTTAAAGGCAAGGGTTGACTCTTTGTTTTATTTTGACATGGCATG
TCCTGAAATAAATATTGATTCAATATGGC
agatgggtcatattctttatttggaagaagttgtgacttctgacatgggtgtgattgtct
tcctacactgttgcatttgattctttttatgtatttttaagaaagtaaccagttatactg
cttttaatattgattggtctttttatttggcttggagttcttcaaagcattgaagtgtgt