Gene PRG2 Variant 1
DNA : 3.26 KbNT_033903
mRNA : 825 bp NM_002728
CDS : 669 bp NP_002719
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  37 bp
atcgggagagaaatcttcactgaatgaatgagtgggctccccagggaagtgatgaaatgg
tccttatcagccttgctatctccctctgacagaggcaaactctctctccctgggggaagt
tcctccaaggcctctatataagaagtctttgtgagaggaagcaaagaaggacctgggctt
TGGGAAGATCTAAAGACCCAGGAAGGTCTCTGGGTGG
gtgagtgctttctctgctgtggtggagctggtgacagtttattctcccaggaggtccctg
gctgtggctgacagtttctggagggctggcaggcgtctacctgtggctttcaggttatga
ggatgtcagcaggggcagccttcatcctctgccttgcacattccttctgcgggatgtgaa
EXON 2  70 bp
gcgtcctggatcctggagcatcaggagctgggcttggcatgagcttttctggcccatcct
gatttctattcaggccttctttttctccacctcactcccacggtcccctaatggtgtgat
tgtgatgtgtgtgcatgtgtgtctgtgtgtgtcaatgacaaactgtgttctccgttgcag
GATAAAGCCAAGATGAAACTCCCCTTACTTCTGGCTCTTCTATTTGGGGCAGTTTCTGCT
CTTCATCTAA
gtaagtgttttttgccttcagtctttctttctctgttttttccctttctatggtagatgg
ggtcagagttacacacccacccccttctttgatcgtcttctatttctgaatttctgtgtg
cttaaagggatggggactctatggccaggagttgaaaggatttctcaaggcgtctgttat
EXON 3  308 bp
ttaaccaccttgaccttgtcaggcagcttgggttcccctcatagagactgggttccaggt
tccccttcccaggcagagttgagcactctgatgcccagggcaaggtgtgagctgtctgtg
gttctggggaggaacaaggggagatgtgaaggaaggacacttagctatcctccctgccag
GGTCTGAGACTTCCACCTTTGAGACCCCTTTGGGTGCTAAGACGCTGCCTGAGGATGAGG
AGACACCAGAGCAGGAGATGGAGGAGACCCCTTGCAGGGAGCTGGAGGAAGAGGAGGAGT
GGGGCTCTGGAAGTGAAGATGCCTCCAAGAAAGATGGGGCTGTTGAGTCTATCTCAGTGC
CAGATATGGTGGACAAAAACCTTACGTGTCCTGAGGAAGAGGACACAGTAAAAGTGGTGG
GCATCCCTGGGTGCCAGACCTGCCGCTACCTCCTGGTGAGAAGTCTTCAGACGTTTAGTC
AAGCTTGG
gtgagtggcctatggctgaggctgaggtgggagcatggaacgggtgtgggatatgccccc
agcattgctatcactggctctttttcccattgagggccctgggggtgtcagtagaacctg
agcctcagagaggtgttggggtaagaggggagggccacctacaaacagaagttgcatttt
EXON 4  132 bp
gcctcagagaggtgttggggtaagaggggagggccacctacaaacagaagttgcattttg
gtctccaaccttcaaatggttgtggcaggggagggagggaatgaattgtggggactcaag
acccatgtgaattcatgtaggaaggatgctccattctttgtcttttatcctgccctgtag
TTTACTTGCCGGAGGTGCTACAGGGGCAACCTGGTTTCCATCCACAACTTCAATATTAAT
TATCGAATCCAGTGTTCTGTCAGCGCGCTCAACCAGGGTCAAGTCTGGATTGGAGGCAGG
ATCACAGGCTCG
gtaagagaagtgtgaacactaaatggggtgcacctgctgatctcagccagcactcagctt
gcatcagatttgtctgtttttctcctgtataatctccagaagaaccagggatagatggac
acccacagacaacactgagggggctgcctgggcattcagggaagagctaaggatttagaa
EXON 5  112 bp
tctgatggtgataattgccgtggatcagcatttcagatgactaggacagttcccatcatg
gtccagcagggaagggcccattgcccggtgggcagcagaaagagctggcagatacggggc
caggtctgcttctctgccttccctctgccccatcccttcttcccctcttgctttctccag
GGTCGCTGCAGACGCTTTCAGTGGGTTGACGGCAGCCGCTGGAACTTTGCATACTGGGCT
GCTCACCAGCCCTGGTCCCGCGGTGGTCACTGCGTGGCCCTGTGTACCCGAG
gtgaggtggggctggggatgaacgatggaaaggtctgggagatgggaagtgccccaagga
ggagatgctacaaagagcctgaccctttgtgggagaggcttcctgggtcttttatatact
ctgactccacagcagtgtgtgggtgggaaaagaggccctcctgtgggttgagttgggatg
EXON 6  166 bp
gatgggaagtgccccaaggaggagatgctacaaagagcctgaccctttgtgggagaggct
tcctgggtcttttatatactctgactccacagcagtgtgtgggtgggaaaagaggccctc
ctgtgggttgagttgggatggacaagaggctgaaagtccctttctgttctgccttcacag
GAGGCCACTGGCGTCGAGCCCACTGCCTCAGAAGACTTCCTTTCATCTGTTCCTACTGAG
CTGGTCCCAGCCAGCAGTTCAGAGCTGCCCTCTCCTGGGCAGCTGCCTCCCCTCCTCTGC
TTGCCATCCCTCCCTCCACCTCCCTGCAATAAAATGGGTTTTACTG
aaatggatttattttctcctctgatcgcggatccactctgcttagccctcattgaaactt
cttccttatcatctctccccacaccacaactttcatagaagtgtcagaagctactactcc
ttgaggaggaggatggagggtggagttgggtctatggagccttttggagatggaggaatg