Gene PRDX5 Variant 3
DNA : 3.71 KbNT_033903
mRNA : 616 bp NM_181652
CDS : 378 bp NP_857635
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  290 bp
ccgccctatctgtaaattaggcccatggaagccgagccgcacctcattcctatatgcaaa
ttagctgctccagtgccgaaagctccgccccatttgtagttgcgtcggctgtccagcacc
cagtgcaaacgaggcgtgggtcccggaagctctgttctgcgggtggccgctcgcgcctgc
GCAGTGGAGGCGGCCCAGGCCCGCCTTCCGCAGGGTGTCGCCGCTGTGCCGCTAGCGGTG
CCCCGCCTGCTGCGGTGGCACCAGCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTA
TGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGG
CCGGCGGTCAGTCTGCGGCAGCGGCAGCAAGACGGTACAGTGAAGGAGAGTGGGCGTCTG
GCGGGGTCCGCAGTTTCAGCAGAGCCGCTGCAGCCATGGCCCCAATCAAG
gtgaccgctggcccggccgggcctgacatcccccactacccccatggcaatccccgtccc
gctagtctgagagtatcgctttatttcctgcctgccagacccctcccctccgcccgcccg
gctcatcccttcagaaggccctcgtggctgcccacctttctcgccaatcgtgggggcctc
EXON 2  39 bp
caggctgaggctctgaaggccaagggagtccaggtggtggcctgtctgagtgttaatgat
gcctttgtgactggcgagtggggccgagcccacaaggcggaaggcaaggtgaggtgaggg
gcctgcagggagtcaggaccaggtaggatattcttcttgtgacctttactttctctgcag
GTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAG
gtgagtgttcccctgaccgccacagggacatggcagtgcggggagcagtgggggccctta
gcctcttcaaggatttctgacacttttctctgtctcttcttaggagacagacttattact
agatgattcgctggtgtccatctttgggaatcgacgtctcaagaggtaaaagtggagagt
EXON 3  62 bp
gtaggatattcttcttgtgacctttactttctctgcaggttcggctcctggctgatccca
ctggggcctttgggaaggtgagtgttcccctgaccgccacagggacatggcagtgcgggg
agcagtgggggcccttagcctcttcaaggatttctgacacttttctctgtctcttcttag
GAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAG
AG
gtaaaagtggagagtcctctgtggagagagtcctctgtgggagagagtcctctgtgggag
agagtcctctgtggagagggtcctctgtgggaagagtcgtctgtgggggagagtcctctg
tgtgggagagtcgtctgtggggagagtcctgtgtggggagagtcctctgtggagagagtc
EXON 4  225 bp
ggggagagtcctctgtgtggagagagtcctgtgtggtggtgagtcctctgtgggggagag
tcctctgtggggggagtcctctctggagttctcttgggcccctggctgttcactgcctgt
ctccatgcccagcctccaagcccaggctgatgcagctggctgggcccctctttccggcag
GTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCAC
AGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGAGGCCCTGGGCCAGA
TTACTTCCTCCACCCCTCCCTATCTCACCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTG
GAATGTTGGCCAGATTTCTGCAATAAACACTTGTGGTTTGCGGCC
atctccttggttatgaatggctgtttcgctgagcgccaggcattctggcatcatcacaga
ctgggtgagaatggtgagggcgcagatgggctgaaagggagaatgtagggggtcctgctt
aattaagggggagctagggagggcctttcaagggaagtttttttttttttttttttttga