Gene PAX6 Variant 2
DNA : 21.28 KbNT_009237
mRNA : 1728 bp NM_001604
CDS : 1309 bp NP_001595
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  103 bp
tccaatcggctggcgcgaggccccggcgctgctttgcataaagcaatattttgtgtgaga
gcgagcggtgcatttgcatgttgcggagtgattagtgggtttgaaaagggaaccgtggct
cggcctcatttcccgctctggttcaggcgcaggaggaagtgttttgctggaggatgatga
CAGAGGTCAGGCTTCGCTAATGGGCCAGTGAGGAGCGGTGGAGGCGAGGCCGGGCGCCGG
CACACACACATTAACACACTTGAGCCATCACCAATCAGCATAG
gtgtgctggctgcagccacttccctcacccacactctttatctctcactctccagccgct
gacagcccattttattgtcaatctctgtctccttcccaggaatctgagaattgctctcac
acaccaacccagcaacatccgtggagaaaactctcaccagcaactcctttaaaacaccgt
EXON 2  188 bp
ggccagtgaggagcggtggaggcgaggccgggcgccggcacacacacattaacacacttg
agccatcaccaatcagcataggtgtgctggctgcagccacttccctcacccacactcttt
atctctcactctccagccgctgacagcccattttattgtcaatctctgtctccttcccag
GAATCTGAGAATTGCTCTCACACACCAACCCAGCAACATCCGTGGAGAAAACTCTCACCA
GCAACTCCTTTAAAACACCGTCATTTCAAACCATTGTGGTCTTCAAGCAACAACAGCAGC
ACAAAAAACCCCAACCAAACAAAACTCTTGACAGAAGCTGTGACAACCAGAAAGGATGCC
TCATAAAG
gtgagtccgcttctttcttctcgctttatttttattgcaatattcagacaggtctccccc
ttcctccccccttccttcctcccctctcgccggtcccctcccccactgctacgccgggag
agttgggccggagaagtttccacgcaggagcccaaactttctacttccagcgaaagcccg
EXON 3  77 bp
gacttctgtggcagatgccgctgaaaatgtgggtgtaatgctgggacttagagtttgatg
acagtttgactgagccctagatgcatgtgtttttcctgagagtgaggctcagagagccca
tggacgtatgctgttgaaccacagcttgatatacctttttctccttctgttttgtcttag
GGGGAAGACTTTAACTAGGGGCGCGCAGATGTGTGAGGCCTTTTATTGTGAGAGTGGACA
GACATCCGAGATTTCAG
gcaagttctgtggtggctgctttgggctcaaaacccacaaacagtcaaaacaaactattt
cagtatgcttcttcactatagttcagatagaagaaaataaatcaaaattggggcatcgct
tctactgattaaagggttaactgctaaagaatgtaggggaaacagattggggatattcca
EXON 4  61 bp
agattttgtatgcactgcagggcagagctgagtgaccctcagatcgccccaagaggttga
gtggatcaattcctaaagaacggagattctcctgtcctagccccaggtccacctcggttg
ggagttcaggcctacctgatgcagctgcccgaggattaactcctattttcttgctaacag
AGCCCCATATTCGAGCCCCGTGGAATCCCGCGGCCCCCAGCCAGAGCCAGCATGCAGAAC
A
gtaagtgcctctggtctttctgggacttcgggctcggggtgcgcggacccgagggtcagg
ggaggacacagggactcgcgacgcccgcgctggcccggccgccgaccgactgaggcccgg
ggacctgcggcggctgctccccgctccgcgcccggcagcccgggaggggagggcgtttgc
EXON 5  131 bp
cagggggatgaggatgcattgtggttgtctcctcctcctctccttcttcctcttcccctt
cctcctctcctttctgttcttgttctccctcatcttcctcttccttcttctccctcttct
tcctcttcactctgctctcttctcttcttttcccctttcctctcctctccctttcctcag
GTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACT
CCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCC
GAATTCTGCAG
gtgatcctcccggcgccgccccactcgccgcccccgcggccctccactctcaacgccctc
tcttcatttcttactgtaaacgatgctaattatggacccccccaccctcacccaccccag
tccccagtccccccacccactcccctgccttcccactttcccctctccttccaccatcct
EXON 6  42 bp
ttcaggcagtgtttaagaaaagttttttttttaaaaaaagcttttaaattcgttttttag
ttcaaattgtttgaaagtatcatcatatttgtagtttttagggctacaaatgtaatttta
agaaaaaaagctctctacagtaagttctcataccattgaaggtatatttttgtgttatag
ACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAAC
gtaagcttgtcattgtttaatgcatacttaaacaattttatttttgtcttgaaattatta
ataatgtggttttctgtccacttcccctatgcaggtgtccaacggatgtgtgagtaaaat
tctgggcaggtattacgagactggctccatcagacccagggcaatcggtggtagtaaacc
EXON 7  216 bp
acagtaagttctcataccattgaaggtatatttttgtgttatagacccatgcagatgcaa
aagtccaagtgctggacaatcaaaacgtaagcttgtcattgtttaatgcatacttaaaca
attttatttttgtcttgaaattattaataatgtggttttctgtccacttcccctatgcag
GTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA
CCCAGGGCAATCGGTGGTAGTAAACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATA
GCCCAGTATAAGCGGGAGTGCCCGTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTG
TCCGAGGGGGTCTGTACCAACGATAACATACCAAGC
gtaagttcattgagaacatctgccctccctgccctaagcccaatgctctctcctctttac
ctcctcccaccctctctctccactgtctcttagtctgtgtcctctccctgctccacattt
gtctcctttgtacctgggggaacagagaggaatgccctgacttttctttgactgtctgga
EXON 8  166 bp
cccaaagtgatagctatcattttttccacggtgtatctgcaaatccacccactgtcccgg
ggtggctgggagctttttaacgggttgagagttgctttttaaggttgtgggtgagctgag
atgggtgactgtgtcttcaggagacactaccatttggtttgattttggtttgatttgcag
GTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCA
GACGGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACCCGC
CCTGGTTGGTATCCGGGGACTTCGGTGCCAGGGCAACCTACGCAAG
gtaaaacccaagcagccatccacgcagctctccatatgtgcatccctttgcctgtcccct
actctcccaaccatttcctctcagggcttccatgcttggggaatgtcatgggtgagactg
catttgaaggcctgggacacatcgaccacattgtatgtaggtggtgtttgttgaaccatt
EXON 9  159 bp
tggtcaggtaactaacatcgcaaatgtatttttttaaaagaaggctgacagttaccttgg
gaatgttttggtgaggctgtcgggatataatgctcttggagtttaagactacaccaggcc
ccttttggaggctccaagttaatccaaatttctcttaccatcctattctttttgttccag
ATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAATACCAACTCCATCAGTTCCAACGGAG
AAGATTCAGATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAA
CATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAG
gtgatagagtttttcaaagtagagaagcagtaaatcaaagtaaatgccacatcttcagta
caaagagctaaatttagccagggccctttgcatagaagaatgaaaagatttccttttttc
tgtctttttatttctctgggcatcttttcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgt
EXON 10  83 bp
aaaatttaacttggttctggtgggaaagttcttccaagtacagtcaacactagaagcatt
ttaaagggaattggttggaggtaatgggagtggggaggtgggaaccagtttgatgcacag
tttggtcaacatattttgtgtagttctggcacaatatggaaaatcaacttactctttcag
AGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAG
ATCTACCTGAAGCAAGAATACAG
gtaccgagagactgtgcagtttcacactttgtgattcataccatttgtctttcctagaga
cagaggtgcttgtacagagtactatttatttataggactaatataataaaaaggttcagt
ctgctaaatgctctgctgccatgggcgtggggagggcagcagtggaggtgccaaggtggg
EXON 11  151 bp
tttcctagagacagaggtgcttgtacagagtactatttatttataggactaatataataa
aaaggttcagtctgctaaatgctctgctgccatgggcgtggggagggcagcagtggaggt
gccaaggtggggctgggctcgacgtagacacagtgctaacctgtcccacctgatttccag
GTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGA
AGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTC
TACCAACCAATTCCACAACCCACCACACCGG
gtaatttgaaatactaatactacgaatcaatgtctttaaacctgtttgctccgggctctg
actctcactctgactactgtcatttctcttgccctcagtttcctccttcacatctggctc
catgttgggccgaacagacacagccctcacaaacacctacagcgctctgccgcctatgcc
EXON 12  116 bp
agcaacacacctagtcatattcctatcagcagtagtttcagcaccagtgtctaccaacca
attccacaacccaccacaccgggtaatttgaaatactaatactacgaatcaatgtcttta
aacctgtttgctccgggctctgactctcactctgactactgtcatttctcttgccctcag
TTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCT
ACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATAACCTGCCTATGCAA
gtaagtgcggctggtggtggcctgcataacccaggccccagagaagtgaggagtggctca
gggcctgcggacctcattggctgtgtctgcacccttgagagcttttcgcactacagtgat
tggcttgaccagtcaagtcggagacagtcaatcccatcacttttaagtgattgactcatt
EXON 13  151 bp
ccagtggaaggactagctcgaggcccaatcttagatttatcatatggaattccagtactt
cacgtgaaggcatctttaatgatcagacttgttggcagagttcctcgggaggagggagcc
tggggctgtggctgtgtgatgtgttcctcagtaaccacaggtttgcctctctcctcacag
CCCCCAGTCCCCAGCCAGACCTCCTCATACTCCTGCATGCTGCCCACCAGCCCTTCGGTG
AATGGGCGGAGTTATGATACCTACACCCCCCCACATATGCAGACACACATGAACAGTCAG
CCAATGGGCACCTCGGGCACCACTTCAACAG
gtgagccactgctttctgcaggctgcacagaggcgatctctcttcactagaagtttaccc
aaacagaatctcctggtcttatgggagggcgtgtttaactccttgctttccttgtccctg
ggggatggggattgaaaagggaaattcagttaagctaattagtaactttacaccatatag
EXON 14  84 bp
tctagtttctgaaggtgctacttttatttgtaacaattgaagtgattttaatacagtaaa
aaatgttagaaagtattagtttttttttttttttttttttttgtaaacctataaatttgt
attccatgtctgtttctcaaagggaatatctacatggctatttctttcatccacttctag
GACTCATTTCCCCTGGTGTGTCAGTTCCAGTTCAAGTTCCCGGAAGTGAACCTGATATGT
CTCAATACTGGCCAAGATTACAGT
aaaaaaaaaaaaaaaaaaaaaaaggaaaggaaatattgtgttaattcagtcagtgactat
ggggacacaacagttgagctttcaggaaagaaagaaaaatggctgttagagccgcttcag
ttctacaattgtgtcctgtattgtaccactggggaaggaatggacttgaaacaaggacct