Gene PARVA Variant 1
DNA : 153.24 KbNT_009237
mRNA : 4087 bp NM_018222
CDS : 1119 bp NP_060692
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  228 bp
gggcagttttggggcatcctccctgcttggggcaacccaggggcgcaaggcgcggccccg
ggagcgcagctccttccagggcagagggcggcgcgagggagggagcgagggagggagcga
gggaagggaaaggcgagcgtgagctgcctcaaatgcttggaataattccgcttccgtttg
GAAAGCCGCAGCCTCAGTCCCGCCGCCGCCCGCTGCGTCCGCCCAGCGCCAGCTCCGCGT
CCCGACCGGCCCGCGGCAGCCTGCGCCGCGCCATGGCCACCTCCCCGCAGAAGTCGCCTT
CTGTCCCCAAGTCTCCCACTCCCAAGTCGCCCCCGTCCCGCAAGAAAGATGATTCCTTCT
TGGGGAAACTCGGAGGGACCCTGGCCCGGAGGAAGAAAGCCAAGGAGG
gtgagtgcggccaggccggccgggcgggcggtaggagccgggggtgccgtaggggccgag
gggccggggcactgggaccgggcgggagcgcgccgcgggtgcccggcgcggtggggcgcg
cggcgatgcgtgcgcgcgcttcccgggtacgtcgggcaggagcgacgcgcaccccacact
EXON 2  90 bp
gggacaattaggtcctttcagccaggcgaggccatgaattgatcgtaggctgagtaacag
ctgtaatctacccttagtgggtttttttctcaatgtcaatatcgaacacccttgttacag
agctccaaccccctgccgtccgtcagctgaaatgtgaccctgctcttccttttcttccag
TGTCCGAGCTGCAGGAGGAGGGAATGAACGCCATCAACCTGCCCCTCAGCCCAATTCCCT
TTGAGCTGGACCCCGAGGACACGATGCTGG
gtaactgtgctcttgtctctgaattcgcttaagctttcccatgccagcacccccactgaa
ttccttttctttttaaagaggagaatgaggtgcgaacaatggtggatccaaactcacgca
gtgaccccaagcttcaagaactgatgaaggtaagaagaaatcaggagcggcttcaggtgc
EXON 3  71 bp
cttttcttccagtgtccgagctgcaggaggagggaatgaacgccatcaacctgcccctca
gcccaattccctttgagctggaccccgaggacacgatgctgggtaactgtgctcttgtct
ctgaattcgcttaagctttcccatgccagcacccccactgaattccttttctttttaaag
AGGAGAATGAGGTGCGAACAATGGTGGATCCAAACTCACGCAGTGACCCCAAGCTTCAAG
AACTGATGAAG
gtaagaagaaatcaggagcggcttcaggtgcctcactgacccaccatgtgtccatatgcc
acctgctctgtgcaggtaccccacgagcccctgagagaaggtaaaaagtcatggcagccc
ctgcctcaggcagtgagttgtctagcagatggccatcgaaaacgtaaccgattgtttaag
EXON 4  103 bp
gagcccaggagtttaagtccagcctaggcaacatagtgagaccccatctcaaataaaatg
aaacttaaaatctaaagttaatttggattttaattgtttaggataagaaagctggtctgt
aagaaaataccccataactcttttcttactattgcacattccctttctctctctctgtag
GTATTAATTGACTGGATTAATGATGTGTTGGTTGGAGAAAGAATCATTGTGAAAGACCTA
GCTGAAGATTTGTATGATGGACAAGTCCTGCAGAAGCTTTTCG
gtaggagagttgagtgctgcaatggatgtgtgtttaattgcaggtggttggatcacctac
ttgtagctagaaggagttattctcagtttacagtggcttacctggaaatggattacaaat
gtgtggagcatggaataacagctcagtgaaggctttagatgtcctcttggaatgtttcat
EXON 5  141 bp
ccaccataaggtgatgaggggacagcagtgtccctctgctggtaggcatccagtatctat
tgttgcaagagtgcatgcatgcatgagtgcatgagagaccgaataactgagtaagtgcat
gcagtagggttgtctggggcccagcataacagctgttctcttttcccttgtcaccctcag
AGAAACTGGAGAGTGAGAAGCTAAATGTGGCTGAGGTCACCCAGTCAGAGATTGCTCAGA
AGCAAAAACTGCAGACTGTCCTGGAGAAGATCAATGAAACCCTGAAACTTCCTCCCAGGA
GCATCAAGTGGAATGTGGATT
gtgagttgaacaaaggaaaggggcaccattaaacaatgcctgtggtccctgccatggggc
ttccccaagaagccatccataagcttggcaggcttcaggggagggggtcaaactcattta
tctttgaacaagttgccccgcttcctcagaacttggaagaagttccatccatacccttgg
EXON 6  116 bp
tccaaatacctcccaccaggccccacctccaacaccggggattacatttcagcatgagat
ttgggcagggacaaatatccaaactctatcagtggggtactactacactttgaacatctg
cttatattgcctagaacctggaagaagatgctgtaatttttcaatcttctttcatttcag
CTGTTCATGCCAAGAGCCTGGTGGCCATCTTACACCTGCTCGTTGCTCTGTCTCAGTATT
TCCGCGCACCAATTCGACTCCCAGACCATGTTTCCATCCAAGTGGTTGTGGTCCAG
gtaagacaggtaacactacaaacatctgtgtctttaaagagtcgtggaggtcgagttcct
atggtgcgtcgagtaggtcattagaaggatggctgcatgaatgttgagtgagcctgggtg
tgcagtatattgggaggcactgaatgagctttctgttgcatgttggcttcccctggtaag
EXON 7  59 bp
gttcagtccagtccctgaaaatcaggacctcctttcacttccagcattatcttatcttgg
gtgcatttcttaaacaccagtaactttctcattatcaggaatgctcatcagtgtttctgt
atttttctaaagcatagttttctcttctcctcccaacccctttccccacccccatttcag
AAACGAGAAGGAATCCTCCAGTCTCGGCAAATCCAAGAGGAAATAACTGGTAACACAGA
gtatgtcaacaccattgttgccagcgattctgtaatggaacacagatgtttctctgaaat
tcatccatttgctgatatttagttttcatttattgggattgcaggagggattagacttca
gccaatgattatagtttagccttttccatgcattcaaaacatgcctctcaatgcttaagg
EXON 8  20 bp
aggccgtgcagaataaaatgccaatggaaggaggctttttgagctcctcaaccaagggca
ggtgggtggcaggcagcatggggtgggcttccagcagtgatggagtgtcctttcagagga
ctggcctcttataagggacaagagaagagtcacactattttctttctctttttcctccag
GGCTCTTTCCGGGAGGCATG
gtaagtcacataagattgtcctctggcactggtggctgcactggggctttagttaattcc
gcagcagctgggaggaacaggctctcagcttgtcacctggatatacgtcttcaccagcct
gggtgacatggccaattgggttgggagggacagcttactggcgggaagaagactacctac
EXON 9  62 bp
tcaccccaaatcttagccccaaatcacattccagagttcccggcacagtctataccccag
aggcttcccatcggtagttgaccttgtgaccttgagaggcgcgtggctctgggacccaag
gtgggcttccctgccagggatcagctcttgtgctccacattgtgtttccctctttttcag
AACGTGATGCCTTTGACACCTTGTTCGACCATGCCCCAGACAAGCTGAATGTGGTGAAAA
AG
gtgggaaaggggtgcctgggatggacagagggaagcgagatgcaacagaacattgggaaa
acccatccctgcagcttgcgagcttcctgccagaactggtggcatcacctaacctctgca
cacacagggctttcccccttgccatccatgtacctgtctgttcctcactggatgttgcac
EXON 10  69 bp
gtggccctccctgtgcactcaatggcctttgcagagagagctcctgggcccagggctctt
ggctgggcctgatcctctgctttcaccctcacccttgccctcacgggagtcacggagcag
ccacaggctcctgcactagtgcgagtccccagcttagggcctgctttgcttctcttttag
ACACTCATCACTTTCGTGAACAAGCACCTGAATAAACTGAACCTGGAGGTCACAGAACTG
GAAACCCAG
gtgggtgacagaccccagcacaggtagaggcagggccctgccctacagcccctgttccaa
gtggcccaccacacttggccaggagggctttcccagctgagggggatgagggcatgggaa
tctgtcctactctgaggggtggactgagtctctgtggattttttccaactttttattatg
EXON 11  102 bp
ccagccagacgtggggcagagcagacctccttgtctcgggccactgcccctacccccgag
ctagcagcctggctggggtggtaggcttcaggtggcatagcacagaagttgatgggcccc
ctggatggggattggctgggaggctcaggggccagtgccatcacctggctcttcctccag
TTTGCAGATGGGGTGTACCTGGTGCTGCTCATGGGGCTCCTGGAGGGCTACTTTGTGCCC
CTGCACAGCTTCTTCCTGACCCCGGACAGCTTTGAACAGAAG
gtaaggagaagggacatcaagggaggccccctagcccacatcccctgactcatgtgccca
cacccatgctggggctatccagaaaaaaggcagaagcttcccctctgctcaacgtcttca
gtgcctggaggtgggacccattataagagctgagctgggaaggagctacctgcagaccac
EXON 12  73 bp
gctaggatcagctagctcacgctccaggtggcctgcccattttggtagccatatttctcc
ttgaaattagttcagcctctgtccctctggctacagtgctgggctccttcacttcccagg
gccaggtcctggggctcctgggtgtgcaatggtacatgctgtctgcatctctcttgccag
GTCTTGAATGTCTCCTTTGCCTTTGAGCTCATGCAAGATGGAGGGTTGGAAAAGCCAAAA
CCGCGGCCAGAAG
gtactttgctctttcctgggtttgtgacaacagagtgagaccctctccctgcacatgagt
actcagattttgtagcagagggaagcattttctgaagccttcgttgctggggaaggtggg
actcggtgcagctgctcagtcccagagaccctttgtgagctgccagctgcacagccaggg
EXON 13  2953 bp
ccccagcacctctaccctcactgccccctgctctgaattctcgctgcccactctacccat
ctgccccgaacatgctgggtacatgggattgggtggtgggtggaagggaggggcagtgta
tgccagctttggaacatgtggccccatggaaacaattggtgttttttgttttctacgcag
ACATAGTCAACTGTGACCTGAAATCTACACTACGAGTGTTGTACAACCTCTTCACCAAGT
ACCGTAACGTGGAGTGAGGGGCTGCCCTGGGCCCACCACTGCCCAAGAGTTCTTGCTGTT
GGCGTACTGGACCCTCCTCCGAACTGCCTTACCCTGCTTATTCCTGTCTCTTGCACTGTG
CTCTCCCACAAGTCCAGCTGCAACCCAGAGATAGTGGAAACTGAAATTAGGAAGGAAATC
ATCAATAACTCAGTGGGCTGACCCATCCCTCCCAGGCGCTGGGGACCAACCTAGCAATGA
AGGTTGGGAAGGTTGTTCCCTTCCCGGTGCCAGGTCCAGATTTCCCTCCATGATTTGGGA
ACCAGCTTAGGCAAAAGAGTCCCCACAAGATGAAAATAAAGATCCTAGTTACCATTCAAA
GGATGCTAACTGTGTGTCAGGCCCCACACTAAGTGCTCTGCTCTGATATACTCAAGGCCA
TTAATCTTCAGGACTCCCATTGACGTAGGTGTTTCATTCCCCTTTTACAGATGAGGAAAC
TAAGGCTTGGAGGTTAAATGACTTGCCAGAAGTTGGAATTTTTTTCCTCTTTGAACATAA
CCTCTCCCTTCTCCCTAAAGGTAACCACTATTCTGAGTCCAATCATCAAGGTTTTGCTTT
TCTTTTTAGCTAAGTATGCATTCCTCAATAGTAGACAGTACAACATGTTTATAACAAGCC
AATTACATTATGTTCTTTGCATGTTCTAAAGTTGTGTATGTGTGTGCACATCTGAGCACG
TGCACATGTACACCTGAGCCAAAAACACGAGAACCCACTGATCTCACCACTGGGGCAAGC
TAGGTCAGAGCTTAGTGATTCACACTGAAATTGGCAAATTGGATTTAACCCAATTAATAG
TGTGTGTGTGGCAGGAGTCATGTCCCTCACATCCTTTGTACAAATGAAAATTACTCTTAA
TTCCTTCAGATTTATAATAACTCTGTACTTTGGTTTCAGGGTGACATTTGGGAAGGATTT
TGTTTAGAATTAATGGAGTGGCACATTTTGCAGCCTTTTTGCTTGATTGCATGTAATGGA
AATGCCCTATATTTTCCTGCAAAATAAGTACTAAATTCATTATCGTTAAGCAAATGTACA
ATATGCTCAGGCACCGCAGAGAGCTGGGCACGGGCCCATGTGAGCATCACTTTGGAAGTA
GGGCTCTTCAACAGGGACCCTTGAACTTTAAAGAAAGGAACTTCTTTTTGCCTTCTAATT
GATCATTTAGACTATTCTGGCTAAGTCTGCCCACATGTAATTACCGGCTAATTCAAGCGA
GGAAAAATGTAAGTCATTTAGACCAAAGCCAAGCAGTTTCTTTGCGTGGGTTACTCAAGG
GCTTGTGGTTACTTGTATCTCCTCTATGTGAACTTGACTTTGAAAGACAGAGCTCTAGTG
TGCCAGCCTGCTAAGTCCTGTAAGAATAGGGAAGGGCGGAGGGGGGTGGGCAGTGACTAG
GGGACGAGAAGCATGGGGAAAATATTTGCACTCTAAACATACAGAGATAGAGGTGGGGCT
TGTGGTACTTAACACTTGTAGCCATCAACTGACTGAGACCTTGGGCTAAATAATCAATTG
TGCTGATATTACATCTCGTTATGGAATGTTCCTAAATATGCCAGGTAGACACCAGCCCAA
GTACCCTCCTCCAGAAGTCTGTGACTACCTTGTCACTACTTTAGGCCCATTCCACAAAGC
CCATCTCTGGTTTGAGAATTCATTTTGATCTGTATCTACACCACCCAAAGTTAGGCCTCC
TATAATGTCCAAAACATTCCTTTCAGCCTTTTTATTTCTTACTGTACTGTCTCTTACTGT
ACTGTCTATCTGCAGTAATTGAGGACCCATAAAATTTAGATAACTACATGTCTTTGCTCT
TAGAATTGTCACTCAGCATAATGAGCATTTAACATACAAAGGCAATGTACTGTTTTGTGT
TGATCTATGTAAAAGAATACAATTCTTTTTTACATAATTAGTGAAATTTTATTTTTTATT
AGGAAACACTAAATAGTGTAATATTTCTTTTGCTTTTAAAAAAATTCCTGGTAGCAAATC
AAGATAAATAATTGCTTCATTTTCTTGAGCAATACTGAAGCAGGATGAAGTAAGAGGAAT
GCATTCATTTAAACATGCTTTGCTTTATGAATTTTGTCTCTTTTTTGGTCTCTTTTTCTT
ATATTCAAGTTACAAATGTACAAGTATCCTTACTAAGAGTGCTCCTTTTGTATTTTACAT
ATATACAGTATGAAAATACATTGGAACACTAGGAAAGTTTTTAAATAACAGTTCTAATTT
ATCAGAAAATTGTGTTTTGGGATTGAGTTCTTTGTCTCAGCCCAGAATCCCAGGTCCTGG
GCCTGGTTTTCTAATGCTGTCATCTCAGTTCGATATTTTACTTTAGAACCTGGAATCTCC
TACTTAATATATGACCATGACTTTGAAAGGCAAAAGAGGAATCAAGAATAAATAAAACAA
ACTTAATCTTCATCTTTAAAAAAAAGAAAAAAGAAACCAAAATGAGAATCAACACTTCAT
AGGCTCACTGGGTTTTCTTTTCTTTTCTGTTAATTTAAACTCAGTTATTTTTAATGCTTA
ATACATACATGGTGCAAAATTTAAAAAGCGCAAATAGGTATCTAGTGGAAAACCTAAGCC
TCCCTCTCTCCTCCGGCACCCATTACCTCTCCCTGGAGGCAACTGTTTTGATCCATTTCT
TACACACACTGCCAGAGATACTCTAGGCATGTAAAGCACAAACATACATATAAAATCTGC
GGGCTTCAAAAAATATAAGTAGGATGTCATCTATACTGTCATACACTTTGTTTTTTATCA
CTTAATGTTATATCTTGGATATTGTATTACCCTGGGTATTAAAAAGAACTCCTTTCACAT
TTTAAAATAACAA
tctgagcacttcataaatccaaatgcgtatctccagtctgctcgagctaggaaaggaaaa
aagccctagccgaaggaggaaaggctgcctagacaatgatttcaaaagtagagtctaaaa
cctatggggtgcaggaccagaggctggggcacattatcagaggcatcctcatgtgcctcg