Gene PAK1 Variant 1
DNA : 69.55 KbNT_033927
mRNA : 1945 bp NM_002576
CDS : 1638 bp NP_002567
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  208 bp
atatagtaggcatttacatcagtgagtgttagcaatatcatggtgtgcagtggaaggact
tgagctagaccctgaaggaagggctgtataattttgattctttgcaattttttaacatgt
atttccttttggtcaaaaataataaaagagttatattgttcttatttctgattctagtag
CTGCTGCTGGTGGTGACAATGTCAAATAACGGCCTAGACATTCAAGACAAACCCCCAGCC
CCTCCGATGAGAAATACCAGCACTATGATTGGAGCCGGCAGCAAAGATGCTGGAACCCTA
AACCATGGTTCTAAACCTCTGCCTCCAAACCCAGAGGAGAAGAAAAAGAAGGACCGATTT
TACCGATCCATTTTACCTGGAGATAAAA
gtatagtatttgattttcttctcatcatttatatgctttaaaaaaattattttgggtaac
ctggataaaagatctgttgtctttgacttaattttcctttaatgttttctttctggttaa
atatttccctttctccctacagtggctgaagcaaaatggaaaatagacctatttttatac
EXON 2  101 bp
taaacatgcattgagtatctgctccaatccagatccgtaactgagctcttctacatatgt
gaaatattaatagatagactttgccctctcaaggagactacagctcaataaagagctaaa
ataagcctaaaaacaataatgttcctgttttttatttccttttgcctgtttctcttgcag
CAAATAAAAAGAAAGAGAAAGAGCGGCCAGAGATTTCTCTCCCTTCAGATTTTGAACACA
CAATTCATGTCGGTTTTGATGCTGTCACAGGGGAGTTTACG
gtaagtcctgggtcacagaaaggtctttagtcttttagagttctggctgtgcactgttag
attcaaccctttctcatcttcctgatgcttctatctttgcctgagaccctgattacaatt
ttctcacgttcatgagtgggacactttcatcgccaaaattgtatccagagaagcctttcc
EXON 3  148 bp
actaattcaatgagaaagatattataaaagaggcttgtgtaaactctgagagtatagaga
gaaaggaatgactaataaatgcatcttttgctgctagcaagtgtcaaagttagctctgat
gttctttcaggctcccctgtgactgtgccttcctgttagtcttgcatgtctctcttacag
GGAATGCCAGAGCAGTGGGCCCGCTTGCTTCAGACATCAAATATCACTAAGTCGGAGCAG
AAGAAAAACCCGCAGGCTGTTCTGGATGTGTTGGAGTTTTACAACTCGAAGAAGACATCC
AACAGCCAGAAATACATGAGCTTTACAG
gtatgagaactgcgtccagggcagtctcagcaagagatggttttaatctgggtgggaaag
ctcacatgcctattagtctgggatgagagaagaaagtagtggaaagagtggaagtggcac
tttaacgtggaattttggaatttgacagccaagatgatggactttgcatcaaacttgagt
EXON 4  38 bp
aggattaaagaaggtgatatgtataatgcatttagcatgatatctagcctgtagtaccag
tcatactattactattctctgaatctggcacgtgcttgaccagatagacttcttttgctg
tccagaaaaatttaactgtaactgttattgactaagtcccttgtttttcttcctgtgcag
ATAAGTCAGCTGAGGATTACAATTCTTCTAATGCCTTG
gtaagtctttatttactctattttgatgtgggcagatgtggaggtaaggatcaagacagt
gtggtagaggcagagcctgagctgggaggcactcatattagtcactcctgcacccttggc
ctcagaattcctatctatccaataaagaaattagatataataaatagggggtatcccttt
EXON 5  120 bp
agaagagggagaaacagattgagcttctgagactagctacacaaaggtgagagcttggag
gctaatgtgtatttcagaagggatatcaggatggggtttctcgtgggaggtttggtgatc
ctgatagttaagttccatggcagctggaccagatgcatcttgcttttcttctttgcacag
AATGTGAAGGCTGTGTCTGAGACTCCTGCAGTGCCACCAGTTTCAGAAGATGAGGATGAT
GATGATGATGATGCTACCCCACCACCAGTGATTGCTCCACGCCCAGAGCACACAAAATCT

gtgagtctttggggacctggccagttttgtgatttattagagtaagtggggagagggagg
agttggtgctgatacctagaagtttaatattctggtaggcgtccttagattttggagctg
gtgaaatcactgaactaccttgactaaaggtactttctgtatgattaaagacaaaaaatc
EXON 6  175 bp
ggccattttacccagaatgggtgggcctgggcacagaggaggagtaatatagattttgac
ataagagaaaggatgagtttattggggtttgctctgtggatgttctaacctcacatctag
gagaggttcccctatgctaacaaaggctggtcttgccaaaattttgcactaataatgcag
GTATACACACGGTCTGTGATTGAACCACTTCCTGTCACTCCAACTCGGGACGTGGCTACA
TCTCCCATTTCACCTACTGAAAATAACACCACTCCACCAGATGCTTTGACCCGGAATACT
GAGAAGCAGAAGAAGAAGCCTAAAATGTCTGATGAGGAGATCTTGGAGAAATTAC
gtaaggaatttgtagctttctgaacctttcttcgttttatgactggtcaagcacagagat
ttgctggtcgtaggcttggtccatgcagctggctggccatgcttggtaccttaggcacag
actgcttctcctcaccctgcccctgaacctcccttccctgtctcacagccctggttggat
EXON 7  64 bp
aggtgatgaaacttttggttgagacttatgggggaaaagctgagggcctgtttagcatgc
tttttggctattggaggtagttctttaacccttgccagctacaggggttggggaaatgtg
gaaccttttttgtatcttgatttgggaaaaaatgattcatggtctctgtttctttcaaag
GAAGCATAGTGAGTGTGGGCGATCCTAAGAAGAAATATACACGGTTTGAGAAGATTGGAC
AAGG
gttagtaggggcattttctttccctggagaaatgactttaaagtgtgtgtgccggcatat
atgattttgctttttttttgcctctcataaaccttgttcttctttctccactttacccct
cacccatctggagttgttatgtgagactgacttgagatttggcagaattatgcttaatat
EXON 8  49 bp
cattctctgtactacctcttatagcttcttaaatgtgagaatggatgctgcagggagagg
attatttttactgctcttgtttttgacactcacagattgtgtgtagaactgcatttgaca
aatatcactttattgaacactgtgtttttttccctctttctccgccaccttactgttcag
TGCTTCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAG
gtgagtatccaccacccactgttgctcctttagttctgtttctttttatttgggattaat
ttttagcccttgttaggtcaacaggaacagttctaggtttttttttttttttttgggatg
gggtctcactctgtcatccaggctggagtgcagtggcgtgatctctgctcactgcagcct
EXON 9  113 bp
gctggcttgagacctcactttgaagaccactggtctacatagacaaactgtgaattactc
gagggctaagactgtatcttactcatctttgtttcctgagtacttaaggtctggtactta
gcaggtgctcaataaatgggaatgactatggttgcacattgaatatactcttgatttcag
GTGGCCATTAAGCAGATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAATGAG
ATCCTGGTCATGAGGGAAAACAAGAACCCAAACATTGTGAATTACTTGGACAG
gtatggagtggtgggtcccatcagagggaaagggcctttgggactgattggtggtgaagc
tgttagagaagagggcagtgccagccctcagaactgcctccatttatgagtcttctgtga
tgctgagctctctgtatgtgaccctgtgtaatgctggacaccttttttgctgggaaatcc
EXON 10  118 bp
gattcaaagttagtgattctgttccccagattctgcttttccccaaagtaaagaaccttt
tactttactttgtgctaagacgtagtttcactctgtgtatatgcttagcctttgaaaccc
agtgctatggctcagtgtactctgattgttctctctcaccctttatctgtattcctgcag
TTACCTCGTGGGAGATGAGCTGTGGGTTGTTATGGAATACTTGGCTGGAGGCTCCTTGAC
AGATGTGGTGACAGAAACTTGCATGGATGAAGGCCAAATTGCAGCTGTGTGCCGTGAG
gtaaggccaagggccaagcagtcttgggtagaaagctgcctccatattcctgtctcctga
agttccctgtacagtgagatctcagcctgggctctgtggaattggtagaaattagtgctg
acactgctatcattcctgtattgtacctgtgtttgtcatttctatcaccatgattttttt
EXON 11  100 bp
agatggaagacttgtttctagatctggctctgcgattgatttggggcaagtccttttact
cactggggccttacttcctttattttaaagtgaagaggttgaattagtggattttctatt
aagtcttctgtattatatgtatgtcctttctttctccccctgcccacaccacttcaatag
TGTCTGCAGGCTCTGGAGTTCTTGCATTCGAACCAGGTCATTCACAGAGACATCAAGAGT
GACAATATTCTGTTGGGAATGGATGGCTCTGTCAAGCTAA
gtaagtaggagccttaggaatgataatacttctctgcctgtggggccctgtctcctgtga
gatggtcatcatataatagtaactacgacactcaccaaagggtctttatgatttcatggg
atatgagggctgttttatattttctgtattaatcataggatatcatttcattattttttc
EXON 12  197 bp
ataggaaataggctaggagctagacatgaaggtggtagtcaagtgactttggagagacaa
aggatagcagagctggaagccaggcggatcttgtcacctatgtgtaggtacacagtcaac
acttactgaagtgagtgtatatcctaaatgtatgttctttctcttatttttcttttctag
CTGACTTTGGATTCTGTGCACAGATAACCCCAGAGCAGAGCAAACGGAGCACCATGGTAG
GAACCCCATACTGGATGGCACCAGAGGTTGTGACACGAAAGGCCTATGGGCCCAAGGTTG
ACATCTGGTCCCTGGGCATCATGGCCATCGAAATGATTGAAGGGGAGCCTCCATACCTCA
ATGAAAACCCTCTGAGA
gtgagtgttaccagttctatttcaagttatttgggctgttgtctctagtcccaggaaata
agaatccagggtgttctctgtggttttcaacctggagatcccttttctggatacaactag
tcactgttgaacttaaagtataaatggccaaagaaaaggaatattagaagtcactcattc
EXON 13  138 bp
tcccatggcctttaaatgttcaacctgatccttaggtcatactctttccagtatatatac
acagctgctactttgcatcctagagcataaagcagctgaccatatttctagaacttgtat
atggggaacaagagagagcctcatttggagctcaaggtgattcaccatttttattgccag
GCCTTGTACCTCATTGCCACCAATGGGACCCCAGAACTTCAGAACCCAGAGAAGCTGTCA
GCTATCTTCCGGGACTTTCTGAACCGCTGTCTCGAGATGGATGTGGAGAAGAGAGGTTCA
GCTAAAGAGCTGCTACAG
gtaactgtccttatgcagggaagcacctaattcagggaatcactaaaccaggcctttttt
acttcatgtttgtaaggtactggatattatagaactaggcttctcttctaccacttccta
cactcactctgttcctactgcccttttatccctgggcctttgctcatttattttcttagc
EXON 14  376 bp
gtagatgctgccaaacagttttccaaagtggtctgttttaagatgtccttcaatttgggg
atgatcagaagctttccacacagcaccctttacaaacaaagatgcctttatgtcttgtaa
tggttactggggaagaatgttaaatagtcatgtgtcttttgctatttttctcctttctag
CATCAATTCCTGAAGATTGCCAAGCCCCTCTCCAGCCTCACTCCACTGATTGCTGCAGCT
AAGGAGGCAACAAAGAACAATCACTAAAACCACACTCACCCCAGCCTCATTGTGCCAAGC
CTTCTGTGAGATAAATGCACATTTCAGAAATTCCAACTCCTGATGCCCTCTTCTCCTTGC
CTTGCTTCTCCCATTTCCTGATCTAGCACTCCTCAAGACTTTGATCCTTGGAAACCGTGT
GTCCAGCATTGAAGAGAACTGCAACTGAATGACTAATCAGATGATGGCCATTTCTAAATA
AGGAATTTCCTCCCAATTCATGGATATGAGGGTGGTTTATGATTAAGGGTTTATATAAAT
AAATGTTTCTAGTCTT
ccgtgtgtcaaaatcctcacctccttcataaccatctcccacaattaattcttgactata
taaatttatggtttgataatattatcaatttgtaatcaattgagatttctttagtgcttg
cttttctgtgactcaactgcccagacacctcattgtacttgaaaactggaacagcttggg