Gene P2RY2 Variant 3
DNA : 17.89 KbNT_033927
mRNA : 2588 bp NM_176071
CDS : 1134 bp NP_002555
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  200 bp
ctggcccggcttcggggttggggaacagcgcagggaggtgggtagccgggctcccaggca
cgtgggtctctgcggctgcggcgggacccgggcactggcacccgggagcggcggcgacgg
caccctgagaggagaagcgcagcgcagtggcgagaggtggggtggggcgtctggagggaa
CAAGGCGCTGGGAGAGGCCCGGGGAAGCGGCGGGCCAGACTGGCGCAGGTGCGGACTGGG
CGCGGGGCAGGGGAGGGCGCTGTGGAGCGGCTGTCGCCCCGGGGCACAGTTGCGAGCCGG
CGTGTAGCGCATAACTGGACGGCTTGAACGCGCCTGTGGGTCCGTGGTTGAACTTTGTCT
CCACGGGAGCGTCGGTCTCG
gtgagtgtggacgggcgccccagtagtgaggctgtgcgcgtcagcgtactggggaggtct
gcgtgttagcgggtgagtgtgtgcgcccctcggggcgactggccaagcctgcggaacttg
tctgtgtgtgctccgatgtgagcgtccccgtggcgtgaggcggtggccggtgcccagaga
EXON 2  195 bp
ggaatgcatgagctggggtttgggtgtacagaaggcactcagaccaggacaaacaccagg
ccacctctctgcctccttctggttaaggttaccacaaaggaggtggccctgggggggatt
gacctgggtaggtttccatgaccctgagaccgcactttctctacctccctctgtctgcag
GAGCCCCTTGTGGCAGCAGCACTACCTGCCCAGAAAAATGCTGGAGGCTGGGCGTGGCCC
CAGGCCTGGGGACCTGTTTTTCCTGTTTCCCGCAGAGTTCCCTGCAGCCCGGTCCAGGTC
CAGGCGTGTGCATTCATGAGTGAGGAACCCGTGCAGGCGCTGAGCATCCTGACCTGGAGA
GCAGGGGCTGGTCAG
gtacgtggggtgggggtgggggggagcgggtacgctggccgggaggtgagggcgggtgtg
ctgtcttgcctgtgtctgccctgaactggcttagatcaagcggatctgaaggcaggtgcc
ctgccctgctcccccatcccaggctgtgatgaattcaggctttgaagccagatagctctg
EXON 3  2193 bp
attgtgtgatcctgatatttattcattgatctcatgcattctcaaggttccagagcttgg
aggttccaggtccagatccaagtcagatggcaatgaaagccctggtcaggtggctgtgtc
aggtcccctaggggcgctccggccacaaccctgatggccccacccctcccttccctgcag
GGCGATGGCAGCAGACCTGGGCCCCTGGAATGACACCATCAATGGCACCTGGGATGGGGA
TGAGCTGGGCTACAGGTGCCGCTTCAACGAGGACTTCAAGTACGTGCTGCTGCCTGTGTC
CTACGGCGTGGTGTGCGTGCCTGGGCTGTGTCTGAACGCCGTGGCGCTCTACATCTTCTT
GTGCCGCCTCAAGACCTGGAATGCGTCCACCACATATATGTTCCACCTGGCTGTGTCTGA
TGCACTGTATGCGGCCTCCCTGCCGCTGCTGGTCTATTACTACGCCCGCGGCGACCACTG
GCCCTTCAGCACGGTGCTCTGCAAGCTGGTGCGCTTCCTCTTCTACACCAACCTTTACTG
CAGCATCCTCTTCCTCACCTGCATCAGCGTGCACCGGTGTCTGGGCGTCTTACGACCTCT
GCGCTCCCTGCGCTGGGGCCGGGCCCGCTACGCTCGCCGGGTGGCCGGGGCCGTGTGGGT
GTTGGTGCTGGCCTGCCAGGCCCCCGTGCTCTACTTTGTCACCACCAGCGCGCGCGGGGG
CCGCGTAACCTGCCACGACACCTCGGCACCCGAGCTCTTCAGCCGCTTCGTGGCCTACAG
CTCAGTCATGCTGGGCCTGCTCTTCGCGGTGCCCTTTGCCGTCATCCTTGTCTGTTACGT
GCTCATGGCTCGGCGACTGCTAAAGCCAGCCTACGGGACCTCGGGCGGCCTGCCTAGGGC
CAAGCGCAAGTCCGTGCGCACCATCGCCGTGGTGCTGGCTGTCTTCGCCCTCTGCTTCCT
GCCATTCCACGTCACCCGCACCCTCTACTACTCCTTCCGCTCGCTGGACCTCAGCTGCCA
CACCCTCAACGCCATCAACATGGCCTACAAGGTTACCCGGCCGCTGGCCAGTGCTAACAG
TTGCCTTGACCCCGTGCTCTACTTCCTGGCTGGGCAGAGGCTCGTACGCTTTGCCCGAGA
TGCCAAGCCACCCACTGGCCCCAGCCCTGCCACCCCGGCTCGCCGCAGGCTGGGCCTGCG
CAGATCCGACAGAACTGACATGCAGAGGATAGAAGATGTGTTGGGCAGCAGTGAGGACTC
TAGGCGGACAGAGTCCACGCCGGCTGGTAGCGAGAACACTAAGGACATTCGGCTGTAGGA
GCAGAACACTTCAGCCTGTGCAGGTTTATATTGGGAAGCTGTAGAGGACCAGGACTTGTG
CAGACGCCACAGTCTCCCCAGATATGGACCATCAGTGACTCATGCTGGATGACCCCATGC
TCCGTCATTTGACAGGGGCTCAGGATATTCACTCTGTGGTCCAGAGTCAACTGTTCCCAT
AACCCCTAGTCATCGTTTGTGTGTATAAGTTGGGGGAATTAAGTTTCAAGAAAGGCAAGA
GCTCAAGGTCAATGACACCCCTGGCCTGACTCCCATGCAAGTAGCTGGCTGTACTGCCAA
GGTACCTAGGTTGGAGTCCAGCCTAATCAAGTCAAATGGAGAAACAGGCCCAGAGAGGAA
GGTGGCTTACCAAGATCACATACCAGAGTCTGGAGCTGAGCTACCTGGGGTGGGGGCCAA
GTCACAGGTTGGCCAGAAAACCCTGGTAAGTAATGAGGGCTGAGTTTGCACAGTGGTCTG
GAATGGACTGGGTGCCACGGTGGACTTAGCTCTGAGGAGTACCCCCAGCCCAAGAGATGA
ACATCTGGGGACTAATATCATAGACCCATCTGGAGGCTCCCATGGGCTAGGAGCCAGTGT
GAGGCTGTAACTTATACTAAAGGTTGTGTTGCCTGCTGAGCTGTGCCCTATTGTGTGGTC
GGGGGATGAGGATATGGCAGGGAAGCTTTCACCAGCCACACAAGGGTCCTTTCTCCAATC
CGTTCCCTTCTGCCACCTGCCTTCTCACTAGCTGTCTCAGGAGTAGTCTCATATCAGGGA
TCCTCTCTCCAGGCCCCAGGTCATCCCCCACTGTAAAGCCAGTTGGCTTCTGTGCCTGAC
TCTGTGCTGAGCACAGAGAAAAGTCAGGTGCAGTCCCAGTCCTTGAGATTTCCCAGTTTA
GGTGATGGCCAGTCATGTGCTGGTAAATGTTAAGCCATTTAACTGGAGCTCCGATTTAAC
TGGGAACCCCTTCTTTGTAGAACTGCCCATTTCCATGGTGCAAAAACTCTTATGGCCAAA
TTCAAACTATAAACATGATGTCAACTTCCTTGT
aaaattcctgaaaatttaacaattggttcttgcaagcaggtacaagtcactctagcacac
cactggataatgccgagtggctggggctgtgagccagggggtcagggaagggttcctgga
gtgggagactcctgagctgtagcttctgagaaaagcagctcaccggaagaacatccacac