Gene P2RY2 Variant 1
DNA : 18.05 KbNT_033927
mRNA : 2656 bp NM_176072
CDS : 1134 bp NP_788086
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  134 bp
gagcgtcgccgcccgaccctcccgttgcagcaccggtacagacacgctgaccccgcggcc
ttgtcgctgggcggcgtcccggagcgggtggcgcggtgtctacccgggcgggttgagggc
ggtgccagggtcagtcaaaagtccgccccgccccctgcctggcccggcttcggggttggg
GAACAGCGCAGGGAGGTGGGTAGCCGGGCTCCCAGGCACGTGGGTCTCTGCGGCTGCGGC
GGGACCCGGGCACTGGCACCCGGGAGCGGCGGCGACGGCACCCTGAGAGGAGAAGCGCAG
CGCAGTGGCGAGAG
gtggggtggggcgtctggagggaacaaggcgctgggagaggcccggggaagcggcgggcc
agactggcgcaggtgcggactgggcgcggggcaggggagggcgctgtggagcggctgtcg
ccccggggcacagttgcgagccggcgtgtagcgcataactggacggcttgaacgcgcctg
EXON 2  195 bp
ggaatgcatgagctggggtttgggtgtacagaaggcactcagaccaggacaaacaccagg
ccacctctctgcctccttctggttaaggttaccacaaaggaggtggccctgggggggatt
gacctgggtaggtttccatgaccctgagaccgcactttctctacctccctctgtctgcag
GAGCCCCTTGTGGCAGCAGCACTACCTGCCCAGAAAAATGCTGGAGGCTGGGCGTGGCCC
CAGGCCTGGGGACCTGTTTTTCCTGTTTCCCGCAGAGTTCCCTGCAGCCCGGTCCAGGTC
CAGGCGTGTGCATTCATGAGTGAGGAACCCGTGCAGGCGCTGAGCATCCTGACCTGGAGA
GCAGGGGCTGGTCAG
gtacgtggggtgggggtgggggggagcgggtacgctggccgggaggtgagggcgggtgtg
ctgtcttgcctgtgtctgccctgaactggcttagatcaagcggatctgaaggcaggtgcc
ctgccctgctcccccatcccaggctgtgatgaattcaggctttgaagccagatagctctg
EXON 3  2327 bp
ggtctttatcacaactactcaactctttgtaaacagatgggcaccgttgtgttccaacaa
agctgaatttacaaaagcagactggatctggcctttggactatagtttgtctacccctgt
tctcaagtttgacaattgtgtgatcctgatatttattcattgatctcatgcattctcaag
GTTCCAGAGCTTGGAGGTTCCAGGTCCAGATCCAAGTCAGATGGCAATGAAAGCCCTGGT
CAGGTGGCTGTGTCAGGTCCCCTAGGGGCGCTCCGGCCACAACCCTGATGGCCCCACCCC
TCCCTTCCCTGCAGGGCGATGGCAGCAGACCTGGGCCCCTGGAATGACACCATCAATGGC
ACCTGGGATGGGGATGAGCTGGGCTACAGGTGCCGCTTCAACGAGGACTTCAAGTACGTG
CTGCTGCCTGTGTCCTACGGCGTGGTGTGCGTGCCTGGGCTGTGTCTGAACGCCGTGGCG
CTCTACATCTTCTTGTGCCGCCTCAAGACCTGGAATGCGTCCACCACATATATGTTCCAC
CTGGCTGTGTCTGATGCACTGTATGCGGCCTCCCTGCCGCTGCTGGTCTATTACTACGCC
CGCGGCGACCACTGGCCCTTCAGCACGGTGCTCTGCAAGCTGGTGCGCTTCCTCTTCTAC
ACCAACCTTTACTGCAGCATCCTCTTCCTCACCTGCATCAGCGTGCACCGGTGTCTGGGC
GTCTTACGACCTCTGCGCTCCCTGCGCTGGGGCCGGGCCCGCTACGCTCGCCGGGTGGCC
GGGGCCGTGTGGGTGTTGGTGCTGGCCTGCCAGGCCCCCGTGCTCTACTTTGTCACCACC
AGCGCGCGCGGGGGCCGCGTAACCTGCCACGACACCTCGGCACCCGAGCTCTTCAGCCGC
TTCGTGGCCTACAGCTCAGTCATGCTGGGCCTGCTCTTCGCGGTGCCCTTTGCCGTCATC
CTTGTCTGTTACGTGCTCATGGCTCGGCGACTGCTAAAGCCAGCCTACGGGACCTCGGGC
GGCCTGCCTAGGGCCAAGCGCAAGTCCGTGCGCACCATCGCCGTGGTGCTGGCTGTCTTC
GCCCTCTGCTTCCTGCCATTCCACGTCACCCGCACCCTCTACTACTCCTTCCGCTCGCTG
GACCTCAGCTGCCACACCCTCAACGCCATCAACATGGCCTACAAGGTTACCCGGCCGCTG
GCCAGTGCTAACAGTTGCCTTGACCCCGTGCTCTACTTCCTGGCTGGGCAGAGGCTCGTA
CGCTTTGCCCGAGATGCCAAGCCACCCACTGGCCCCAGCCCTGCCACCCCGGCTCGCCGC
AGGCTGGGCCTGCGCAGATCCGACAGAACTGACATGCAGAGGATAGAAGATGTGTTGGGC
AGCAGTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGTAGCGAGAACACTAAGGAC
ATTCGGCTGTAGGAGCAGAACACTTCAGCCTGTGCAGGTTTATATTGGGAAGCTGTAGAG
GACCAGGACTTGTGCAGACGCCACAGTCTCCCCAGATATGGACCATCAGTGACTCATGCT
GGATGACCCCATGCTCCGTCATTTGACAGGGGCTCAGGATATTCACTCTGTGGTCCAGAG
TCAACTGTTCCCATAACCCCTAGTCATCGTTTGTGTGTATAAGTTGGGGGAATTAAGTTT
CAAGAAAGGCAAGAGCTCAAGGTCAATGACACCCCTGGCCTGACTCCCATGCAAGTAGCT
GGCTGTACTGCCAAGGTACCTAGGTTGGAGTCCAGCCTAATCAAGTCAAATGGAGAAACA
GGCCCAGAGAGGAAGGTGGCTTACCAAGATCACATACCAGAGTCTGGAGCTGAGCTACCT
GGGGTGGGGGCCAAGTCACAGGTTGGCCAGAAAACCCTGGTAAGTAATGAGGGCTGAGTT
TGCACAGTGGTCTGGAATGGACTGGGTGCCACGGTGGACTTAGCTCTGAGGAGTACCCCC
AGCCCAAGAGATGAACATCTGGGGACTAATATCATAGACCCATCTGGAGGCTCCCATGGG
CTAGGAGCCAGTGTGAGGCTGTAACTTATACTAAAGGTTGTGTTGCCTGCTGAGCTGTGC
CCTATTGTGTGGTCGGGGGATGAGGATATGGCAGGGAAGCTTTCACCAGCCACACAAGGG
TCCTTTCTCCAATCCGTTCCCTTCTGCCACCTGCCTTCTCACTAGCTGTCTCAGGAGTAG
TCTCATATCAGGGATCCTCTCTCCAGGCCCCAGGTCATCCCCCACTGTAAAGCCAGTTGG
CTTCTGTGCCTGACTCTGTGCTGAGCACAGAGAAAAGTCAGGTGCAGTCCCAGTCCTTGA
GATTTCCCAGTTTAGGTGATGGCCAGTCATGTGCTGGTAAATGTTAAGCCATTTAACTGG
AGCTCCGATTTAACTGGGAACCCCTTCTTTGTAGAACTGCCCATTTCCATGGTGCAAAAA
CTCTTATGGCCAAATTCAAACTATAAACATGATGTCAACTTCCTTGT
aaaattcctgaaaatttaacaattggttcttgcaagcaggtacaagtcactctagcacac
cactggataatgccgagtggctggggctgtgagccagggggtcagggaagggttcctgga
gtgggagactcctgagctgtagcttctgagaaaagcagctcaccggaagaacatccacac