Gene MYEOV Variant 1
DNA : 3.12 KbNT_033903
mRNA : 2467 bp NM_138768
CDS : 942 bp NP_620123
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  413 bp
aaccgagagagggaaatgttgacggggaagaaagccctgcccaccaggcagccccaccca
cctgggctagccccactcacaagcagccccacccacctgggttagtcccacccaccaggc
agctccgcctaccttggctatccccctctgagttcttgccttgattctcctgttactgtc
CCGCGAACCCACATCCCTACAAAGCAGGAAAGTATGCTTGGGAGAGGCCAAGTGAGTGGG
GAATCAGCCCAAAGCCAGGCGTCCAGGGTCTCCCTCACCTGAAGCTGACTTTTTCCCCAC
CTTGGACAGAGGGCGGGAGATGCCATCCCCACTGAACCCAGTGCTTTCACCAGCCATATT
AGCTCCCACTCACCCCCCGTCGTGGAAGCCTCGGCCGTCACACCTGCAGGGCCGGGGCGT
GCATGGCCTCAGGGATGGCCTGTTCAGCTGCTGGGTGACTCGGGTCCAGGTGCCTCACCA
CCTGCTGAGCTCTGTGTGATTTCTGGACACTTCTGCTCGTTGCCTTTGGGCTCAGTGAAG
AGTCTGGAGTTTATCTGGAGTGAGGTGGCCGGTTCTTGGTGGGATCTGAGCAG
gtaagaagcagggtctttcttatgttttaaggaaagccctgtggctgctgggtgggggac
cagctggaggggcaggagggcagcaggtgactcattacaaggctggggccatcatcctgt
gagagctgggcatgaccagtgcaggtcagtggggttgagggtacagaccagtgggaccca
EXON 2  2054 bp
ggccacccggtggatttgggcaggtcccagcttccaggatcatgaggtgaaaacgtgaag
ggaccctagaggccatggggacccaggcacagagcggcggcctctcatcctccccatggt
caaggaggtcagtgccttcccggggtggattacggatggtagtatcttccttctcctcag
AGTCCATTCAGGAGCAGGAAAGTTCATCTCAGACCCTAAATCCAGCCACGTCATGCCACG
CTTAACACCTCTAACAACTTCCCCTGGCACTTAGGACAGCGTCTGGCTCCTTCCCTCGGC
TCATGGCCCTCAGAATCTGCGTCACATACACCCCAGCTCTCCCGATAGGTCTCTGCACTC
GCTGTTGCCTCTGCCTGGAACAGTCTCCCTCCTGGTGTCATTGTCTCCGTGGTGTGTCCT
TCCTGACCTTCCACCTCCACCAGGTGCCGACACTTCCCTGACCCCAGTAACCTCTTCTCT
TGGGTGGGTGAATGCCACCTGCTGATGTCTGATTTATTCATCGGTTTTCTTGTCTGTAGT
CTGTCCCCCTTGGGGACAGGGACTCGTTGCTCATGTTCACCCGGCAGGCTGGACACTTCG
TGGAGGGCTCCAAAGCCGGCAGATCCCGGGGCCGCCTCTGTCTCTCCCAGGCCCTGCGTG
TTGCGGTGAGAGGAGCATTTGTGTCTCTGTGGTTTGCTGCTGGAGCTGGTGACCGGGAGA
GAAACAAGGGAGACAAGGGTGCCCAGACAGGTGCGGGGCTCAGCCAGGAGGCAGAAGACG
TGGACGTGTCCCGGGCCAGGAGGGTCACAGATGCACCACAAGGCACTCTGTGTGGCACTG
GGAACAGGAATTCTGGGAGTCAGTCTGCAAGGGTGGTGGGCGTTGCTCACCTGGGAGAAG
CCTTTAGAGTGGGCGTTGAGCAGGCCATTAGCTCGTGCCCTGAGGAGGTGCATGGGCGGC
ATGGGCTCTCCATGGAAATTATGTGGGCGCGAATGGATGTGGCTCTGCGCTCACCTGGGC
GAGGACTTCTGGCCGGTGCCGGGGCACTCTGCATGACCCTGGCAGAATCGAGCTGCCCTG
ACTATGAAAGGGGAAGAAGAGCATGCCTGACCCTCCACCGGCACCCCACCCCTCACTGCT
CCACCTGGGGCCTGCCTCTGCGGGTGGCTGGGTCCTGGCTGACTGTTGTGACTGTTGAGG
CCCTGGGGGGGTGGCGCATGGGAGTTAGGAGGACTGGCCAGGTGGGGCCCACTATGCACC
CACCCCCAGTGTCAGGTGCTTCTCCTCTCCTCCTCCACCACCTCCTCCTCCTCCTCCTCA
TCATCATCCTCACTTGTTGAGGACGTCCTGTGTGCCAAGTGGTTTATATGCCCAGCCTCA
TTTAATCCTCAGAATGACTCCATGAGGTAGCTACTAAAACCCCCCACTTAACAGATGAGG
AAACTGAGGCCTAGAGAAGCTCAACAAGTTGCCTAAGTTCCAAGTTTCCTCTCCCAACTC
TCCTACCCTCTCCTCTTCCTTCTCCTTTCTCCCATTCTTCCCTGCCTCTTCCCTAACTAG
ACAATTTTTTATTGAGTGTCTCCCAGGTGCAGGCATGAGCCAGGTGCTGGGAAAATCATG
ATAACCCAGCTCCTTCTGGTCATTTTCTCAGCTGGTTAGAGGCTGGGAGGACACGCAAGT
TCAGCTCCAGCCGACTGGGGCATTGGTGGTAGCCCCTGGAGACATTGTGCAATGGGGCTA
CGAGGCTGCATCTGGCTCCAGGGAAGCGTGTTGCAATCCATGAGTGATGTCTGCCATGCG
TACAGGCATGGAGAGTGAGGCGCCTGTACTGTCTTTCTGTAGACCCTAGACTGGTGGGGC
CTCTGAAATGCATCCAGACACTGTGCTGGGTGTGTTGCATGGCCCTCCCAACCAATTCAG
TATTTTTCTCCCCATTTTCCAGGGAGAAATCTAAGGCGTCAGAATGTAAGGTTCTTATTG
GAACCCAGGCTCCAGGGTCCCTGGTTTTCTGTGACATCATGCTGCAGGACCCTGTTTCTC
TCTTTGCTTTGGCTGCTGGGGAGCTCAGAAGGGAGCTTTAGGCTTGCTCTCAGTCACCAC
ATTAGCTCAGGGGTTTGGGCATTTTTGTCGCCGTCTCCTTTGGGCTCTGTCTCCTCCCTG
CTGTGCTTCCTGAGGAGCAGGCCGGATGTAAGTTATCAACTATAAATAAAACCAAGACTT
CCGTTCTGGCTCTC
actctagtttcctggtgcattttttttttttaaagttcttaatcaagggaggggatactc
ctaactgaagatgacatcagcatcagctggccccggggggcaggcccccagcccccaggc
ccgtgtgggccctgaatgcccccattatgaggggtaacctcattacacaagacacgctgc