Gene MMP26 Variant 1
DNA : 4.23 KbNT_009237
mRNA : 989 bp NM_021801
CDS : 786 bp NP_068573
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  117 bp
aattccatggctgcttttgtcacccttgcatgctggtcactctgccctcagcaggtatgg
atgatgacgccactcacagattcaaagaaagggcaaactggcagagtgagtcattggatg
ttgctggcacagctataaagatccagtggcccaagttgtgtacctgaattcaagcagtgg
GACAAATGAGGGTTTGGCATGCAGCTCGTCATCTTAAGAGTTACTATCTTCTTGCCCTGG
TGTTTCGCCGTTCCAGTGCCCCCTGCTGCAGACCATAAAGGATGGGACTTTGTTGAG
gtaggtgaacgactcaggaccacattattacatggtgaccattgtgggctcttatttcgt
gtgtgtgtgtatgtgtgactgcatggtataatgataaatacacacattaatattacacat
gaaaacattttattctatctatgtgttcatttttctcttctaattttaagaaaaaaatta
EXON 2  221 bp
tttcactgtggcataaagaatcagggatggctgccatcatctgactgagaacaggagact
taggaaggccagactaagtaccgtccttctgagaccctcaaagaaggctatgcccagggt
aactgatatatgggtcttccctattgactcttagtactcatccttcttgatctgattcag
GGCTATTTCCATCAATTTTTCCTGACCAAGAAGGAGTCGCCACTCCTTACCCAGGAGACA
CAAACACAGCTCCTGCAACAATTCCATCGGAATGGGACAGACCTACTTGACATGCAGATG
CATGCTCTGCTACACCAGCCCCACTGTGGGGTGCCTGATGGGTCCGACACCTCCATCTCG
CCAGGAAGATGCAAGTGGAATAAGCACACTCTAACTTACAG
gtgcttgttactaaggcctagaggataatgtgtggggtgatgacctcaaagggctttcta
ccaggtctctcctggaggtacctctactctcttctgctttcattggcagcccgctcaaag
cccaaaatctccctcagagaaggtaatactaccagatccttttctagcttcctctaacca
EXON 3  149 bp
tgcatgtttaattccttaagtttctgatttaattagtctgaaattagctcaactttataa
ataaccaaaatgagtcctaaaactattaaatgattctccccaaagtagaattattcatgt
ttagagctaggataattcccattcctctgaactatttcatttagagattgctttcctcag
GATTATCAATTACCCACATGATATGAAGCCATCCGCAGTGAAAGACAGTATATATAATGC
AGTTTCCATCTGGAGCAATGTGACCCCTTTGATATTCCAGCAAGTGCAGAATGGAGATGC
AGACATCAAGGTTTCTTTCTGGCAGTGGG
gtaagaaattgacatgggaagaaggatatgtatatgccctgtgtaaaggacaaagggttt
ccatccttaaacaaaaacctagcccccctattaaagtttctgagaaaaaaagtctgacaa
aaccctactgcaaagcaaatcctgtaatagggaagacatttttagtaaaatgaagcaata
EXON 4  126 bp
agagtaggaagattttgggccccaccttatttctctgcatagataatgccttagctctct
cacatcccccagtggtagactgttgcacagtatcctaagtctctgaggcttacttaagac
tattctggcctttgtttctacctccaccctcattgtgatcatagcttctgtcgtccacag
CCCATGAAGATGGTTGGCCCTTTGATGGGCCAGGTGGTATCTTAGGCCATGCCTTTTTAC
CAAATTCTGGAAATCCTGGAGTTGTCCATTTTGACAAGAATGAACACTGGTCAGCTTCAG
ACACTG
gtaaatgccttgtttggtgggatcgctagaactctctgggaacctggggttcagtgttga
tggtttccatttagggatccagagtggtcagggtgaggtggaagatttggctgaggaatc
aggtcttctttataagtgaggagatgtgggatcatttctgaacacagatgatcccataat
EXON 5  162 bp
atcttgccattctgttttctacttactttctttccctccttgcctaccttttcctttacc
ctgtaacatttgccctttcctcgttttctgttctctcctttttctttgtcctatttcaca
cactttcagcattccctatgcatagttaattttatcttttttttttctataatttttcag
GATATAATCTGTTCCTGGTTGCAACTCATGAGATTGGGCATTCTTTGGGCCTGCAGCACT
CTGGGAATCAGAGCTCCATAATGTACCCCACTTACTGGTATCACGACCCTAGAACCTTCC
AGCTCAGTGCCGATGATATCCAAAGGATCCAGCATTTGTATG
gtctgtgctgcttaaggaagagaagggagatctgggcaggaaaatttcacctgaaattta
ctgttgttttttttttctgtttccataggagaaaaatgttcatctgacataccttaatgt
tagcacagaggacttattcaacctgtcctttcagggagtttattggaggatcaaagaact
EXON 6  214 bp
gagctccataatgtaccccacttactggtatcacgaccctagaaccttccagctcagtgc
cgatgatatccaaaggatccagcatttgtatggtctgtgctgcttaaggaagagaaggga
gatctgggcaggaaaatttcacctgaaatttactgttgttttttttttctgtttccatag
GAGAAAAATGTTCATCTGACATACCTTAATGTTAGCACAGAGGACTTATTCAACCTGTCC
TTTCAGGGAGTTTATTGGAGGATCAAAGAACTGAAAGCACTAGAGCAGCCTTGGGGACTG
CTAGGATGAAGCCCTAAAGAATGCAACCTAGTCAGGTTAGCTGAACCGACACTCAAAACG
CTACTGAGTCACAATAAAGATTGTTTTAAAGAGT
aatattttgtcctcataatttgatatgtctcagcatttgctatgttcaaccactgtgatc
agaacaagaaagaagtgtacacaacagtggagaactctggcagagatggccacgggactg
caagaaaagaaagcataagattaggaatagacctttgcattttcctacacaggtagagtt