Gene MGAT2 Variant 1
DNA : 11.51 KbNT_033927
mRNA : 1905 bp NM_025098
CDS : 855 bp NP_079374
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  160 bp
aaaggctatacaaccccttctcttcctccttccttagccaggctccagcaggtagattca
aaggtttcttgtaggatagaatttcctgcctcagcaggggcaaggaggccttggggctgg
gctgggctgggctgggtgtggcactctccctgccagcttctacaacctggggagggaaca
AAAACCTGTGGGTGCCTCAGACCACAGCAGAGCTCACAGAACCTGCGGGAGCCAGGCTGA
CCCGCCAGCATGGTAGAGTTCGCGCCCTTGTTTATGCCGTGGGAGCGCAGGCTGCAGACA
CTTGCTGTCCTACAGTTTGTCTTCTCCTTCTTGGCACTGG
gtaagttgggctgcactgtaagacgggagaccaccgcactcaggtggggcagagcagcca
caccaggtgcacacagcacattgatggtggcaagacatttatcctaaagggggctttgtt
gcgctcagagcccctgcccagagagaactcctgggcctgcccagaggcttcttgggggtg
EXON 2  179 bp
cctctcagggactttgtctcctctttgaatgccccggaagctgctgtcttcctcctgggc
ccgaggattggacaggacagtgctgctagtgccaggcctatgggcagagttcagtctgag
caatctcacctgccttcctctcagacccctgtccctgacagctccttcttccctccccag
CCGAGATCTGCACTGTGGGCTTCATAGCCCTCCTGTTTACAAGATTCTGGCTCCTCACTG
TCCTGTATGCGGCCTGGTGGTATCTGGACCGAGACAAGCCACGGCAGGGGGGCCGGCACA
TCCAGGCCATCAGGTGCTGGACTATATGGAAGTACATGAAGGACTATTTCCCCATCTCG
gtgagtattgaggctggttggggttggggagggagttggctggggtgtggtcagggccag
agtgccgacgtctccatgggagaatatggccctgcatgcactgaggagggtactgggctg
ggaggcaggagctagggcttccgctactatgtgacctagagaagagtccagcttctctcc
EXON 3  205 bp
atatctccaggtgctgtcacataccatatctgaatcttcgtaagaacccagggtggtcag
acatatggatgaagacctggaggctcagaggggaggtttcccaaggtcacaccagtgagt
ggcagagtcagggctggtacacaggccccgccctggctcagcaggttgccgtccctgcag
CTGGTCAAGACTGCTGAGCTGGACCCCTCTCGGAACTACATTGCGGGCTTCCACCCCCAT
GGAGTCCTGGCAGTCGGAGCCTTTGCCAACCTGTGCACTGAGAGCACAGGCTTCTCTTCG
ATCTTCCCCGGTATCCGCCCCCATCTGATGATGCTGACCTTGTGGTTCCGGGCCCCCTTC
TTCAGAGATTACATCATGTCTGCAG
gtgagtctttctacccctgagcagctcaggaaggtaacaaattttcggaagggttgccaa
tagttctgtacttcttccaagagcgtgtgcagtaggagaaggaggctaggcccaaagaag
cacttcctacagcaccatgctgggcgctgagtccatcagggggttgggaagagggagaag
EXON 4  1361 bp
gtccatcagggggttgggaagagggagaagactcagggagctcctagctggaatggggtg
cagtgggggaaaaaccccaggcctcagtaggcattgctggtgatctctttatgggctaca
tgtactttcatagcccctgctccctcaccccatacctgacccacttttctctttccctag
GGTTGGTCACATCAGAAAAGGAGAGTGCTGCTCACATTCTGAACAGGAAGGGTGGCGGAA
ACTTGCTGGGCATCATTGTAGGGGGTGCCCAGGAGGCCCTGGATGCCAGGCCTGGATCCT
TCACGCTGTTACTGCGGAACCGAAAGGGCTTCGTCAGGCTCGCCCTGACACACGGGTATC
AAGCCTCTGGGAAGAGCACTCTGGGTTCAGTTGGCAATTGGCAAGGATTTTATTTTGGTG
GGAAGATGGCAGAGACGAATGCAGATTCTATTTTGGTAGAGATTTTCAGTCCATTCACAA
TTAAGATTATATTTTGGTGTCTTATGCCCAAATACCTAGAAAAGTTTCCACAACGGAGAC
TCAGTGATCTAAGAAACTAGGTGGCAATGAACATATTCCACAAAGCTGGCATTTGATCTG
AGATCTGTGGTATCTAGAAGAGTGATATTTGGGGTACATTTCAGAGCTGTTCTCCCTCCT
TGGGGTGAAGCATCCTTGAGAAACATGAGCCAGCTGAGGTGGGAGATATTTTTCTAGGAA
AAACAATGCAGATTTTTATATCTGGGAGGACTCTCTGAAGCATTCTGGTCTACCTCTCAT
GGTGCAACTGGGAAGTTGTGGCCCTGCAAGGGACCTGCCCAAGGTCAGAGAATGGGGCTG
TGAAGGTCTGGGAGATAACCCAGGCCTCCACCTCCAGCCCAGGTGGCTGACCTCTGCTCC
ATTTCTTGGTCACTGAGTCCCTGCAGGAAGCTAAAGGGCCTTTCAGCTCGTGCCTTCTCT
GGGGCCTCCCACATGCCCTCTTTCCTCTATTTGTCTCCAGGGCACCCCTGGTGCCAATCT
TCTCCTTCGGGGAGAATGACCTATTTGACCAGATTCCCAACTCTTCTGGCTCCTGGTTAC
GCTATATCCAGAATCGGTTGCAGAAGATCATGGGCATCTCCCTCCCACTCTTTCATGGCC
GTGGTGTCTTCCAGTACAGCTTTGGTTTAATACCCTACCGCCGGCCCATCACCACTGTGG
GTAAGTCCAGGACCAGGCTGGGAGGGAGGAGGCCAAAGGGACAGGGCAGGTTGTGTGCTG
CAAGGGGACATGGAGATGAGCCAGATTTATTCCTGCCCTAATGGGGCTCACATTCTAGAC
TGGGAAACATACACACACAAGCAGATAGAATAGAAGACAGTCTGGGATAGGAACTATAGC
AGAGGTGCCAACAGCAATAGTTGTGACTAATTGCTGAGCACCTGCTGTGTGCCAGGCACT
ACACTAGCTGCCCTACATGAAGCAACTCAGCTTATCCTAACAATCTTCATGGCAGGATTT
TTTTTTAAGAGTTTTGCTCTTGTCGCTCAGCCTGGAGTGCA
atggcacaatctcagctcactgcaacctccgcctcctgggttcaagagattctcatgcct
cagcctcctgagtagctgggactacagtcgctcgccacaacactcagctaatttttgtat
ttttagtagagatggggtttcaccatgttggccaggctgttctcaaactcctgaccacaa