Gene IRF7 Variant 4
DNA : 3.06 KbNT_035113
mRNA : 1937 bp NM_004031
CDS : 1551 bp NP_004022
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  554 bp
ctgggggagcctgagagatgagggtcgggcggggagggaggcggaggcggaggcggaggc
ggggttccgcggagctgagaaccggacggggtgggatcgaggagggtgcgaagcgccact
gtttaggtttcgctttcccgggagcctgacccgcccctgacgtcgcctttcccgtctccg
CAGGGTCCGGCCTGCGCCTTCCCGCCAGGCCTGGACACTGGTTCAACACCTGTGACTTCA
TGTGTGCGCGCCGGCCACACCTGCAGTCACACCTGTAGCCCCCTCTGCCAAGAGATCCAT
ACCGAGGCAGCGTCGGTGGCTACAAGCCCTCAGTCCACACCTGTGGACACCTGTGACACC
TGGCCACACGACCTGTGGCCGCGGCCTGGCGTCTGCTGCGACAGGAGCCCTTACCTCCCC
TGTTATAACACCTGACCGCCACCTAACTGCCCCTGCAGAAGGAGCAATGGCCTTGGCTCC
TGAGAGGTAAGAGCCCGGCCCACCCTCTCCAGATGCCAGTCCCCGAGCGCCCTGCAGCCG
GCCCTGACTCTCCGCGGCCGGGCACCCGCAGGGCAGCCCCACGCGTGCTGTTCGGAGAGT
GGCTCCTTGGAGAGATCAGCAGCGGCTGCTATGAGGGGCTGCAGTGGCTGGACGAGGCCC
GCACCTGTTTCCGCGTGCCCTGGAAGCACTTCGCGCGCAAGGACCTGAGCGAGGCCGACG
CGCGCATCTTCAAG
gtggggaccccagccccgccccgccccgggtgggagagcccgcctaggaccccgcgggcc
cggcacacgtgttctgtccccctcttcaggcctgggctgtggcccgcggcaggtggccgc
ctagcagcaggggaggtggcccgccccccgaggctgagactgcggagcgcgccggctgga
EXON 2  211 bp
gtggctggacgaggcccgcacctgtttccgcgtgccctggaagcacttcgcgcgcaagga
cctgagcgaggccgacgcgcgcatcttcaaggtggggaccccagccccgccccgccccgg
gtgggagagcccgcctaggaccccgcgggcccggcacacgtgttctgtccccctcttcag
GCCTGGGCTGTGGCCCGCGGCAGGTGGCCGCCTAGCAGCAGGGGAGGTGGCCCGCCCCCC
GAGGCTGAGACTGCGGAGCGCGCCGGCTGGAAAACCAACTTCCGCTGCGCACTGCGCAGC
ACGCGTCGCTTCGTGATGCTGCGAGATAACTCGGGGGACCCGGCCGACCCGCACAAGGTG
TACGCGCTCAGCCGGGAGCTGTGCTGGCGAG
gtgagcgacgccggctgccaagggcgttggcattcgtcctgcttgggcaaaggggaacat
tctctgggtcagatttgtggttttagaagctgttctgggagaggctgccagcaggcccag
gacaggtggagagccacatccccacctcctcaggccacagcctaagggttcacagccagg
EXON 3  59 bp
ttagaagctgttctgggagaggctgccagcaggcccaggacaggtggagagccacatccc
cacctcctcaggccacagcctaagggttcacagccaggaagctggtgggggctacaccag
gctctccttgtatctctcactctggtgtcggggcctaacgcctgccccattctctctcag
AAGGCCCAGGCACGGACCAGACTGAGGCAGAGGCCCCCGCAGCTGTCCCACCACCACAG
gtacccttctctctgcctgcctctcctcctgccaggccgcggagctgcttacgttcaccc
tgacttttccctgcagggtgggcccccagggccattcctggcacacacacatgctggact
ccaagccccaggccccctccctgccccagctggtgacaagggggacctcctgctccaggc
EXON 4  226 bp
ctcactctggtgtcggggcctaacgcctgccccattctctctcagaaggcccaggcacgg
accagactgaggcagaggcccccgcagctgtcccaccaccacaggtacccttctctctgc
ctgcctctcctcctgccaggccgcggagctgcttacgttcaccctgacttttccctgcag
GGTGGGCCCCCAGGGCCATTCCTGGCACACACACATGCTGGACTCCAAGCCCCAGGCCCC
CTCCCTGCCCCAGCTGGTGACAAGGGGGACCTCCTGCTCCAGGCAGTGCAACAGAGCTGC
CTGGCAGACCATCTGCTGACAGCGTCATGGGGGGCAGATCCAGTCCCAACCAAGGCTCCT
GGAGAGGGACAAGAAGGGCTTCCCCTGACTGGGGCCTGTGCTGGAG
gtgtgggcgtgcccggggagggggggagcgcgggaggggccagtgcacctggacggacac
tttagaagggggctggggattggggagctggagaattaggaggggaccaccgttcccact
gtcctcccctcctcaggcccagggctccctgctggggagctgtacgggtgggcagtagag
EXON 5  87 bp
agagggacaagaagggcttcccctgactggggcctgtgctggaggtgtgggcgtgcccgg
ggagggggggagcgcgggaggggccagtgcacctggacggacactttagaagggggctgg
ggattggggagctggagaattaggaggggaccaccgttcccactgtcctcccctcctcag
GCCCAGGGCTCCCTGCTGGGGAGCTGTACGGGTGGGCAGTAGAGACGACCCCCAGCCCCG
GGCCCCAGCCCGCGGCACTAACGACAG
gtgagaggggtaggggttgggaggcctggggcacagggagaggctagggatgaggtgcca
gcacaggattcccttccggatgcaggcgaggccgcggccccagagtccccgcaccaggca
gagccgtacctgtcaccctccccaagcgcctgcaccgcggtgcaaggtgagtgcatccca
EXON 6  81 bp
ctcctcaggcccagggctccctgctggggagctgtacgggtgggcagtagagacgacccc
cagccccgggccccagcccgcggcactaacgacaggtgagaggggtaggggttgggaggc
ctggggcacagggagaggctagggatgaggtgccagcacaggattcccttccggatgcag
GCGAGGCCGCGGCCCCAGAGTCCCCGCACCAGGCAGAGCCGTACCTGTCACCCTCCCCAA
GCGCCTGCACCGCGGTGCAAG
gtgagtgcatcccaggaaggggcagcctgtccccgcccacccccgtcactcacggcttgt
ccccgcccacccatcactcacatcctgtccccgcccacccccgtcactcacatcctgtcc
ccgcccacccccgtcactcacagcctgtccccgcccacccccgtcactcacagcttggtc
EXON 7  390 bp
tcccaggaaggggcagcctgtccccgcccacccccgtcactcacggcttgtccccgccca
cccatcactcacatcctgtccccgcccacccccgtcactcacatcctgtccccgcccacc
cccgtcactcacagcctgtccccgcccacccccgtcactcacagcttggtctccacacag
AGCCCAGCCCAGGGGCGCTGGACGTGACCATCATGTACAAGGGCCGCACGGTGCTGCAGA
AGGTGGTGGGACACCCGAGCTGCACGTTCCTATACGGCCCCCCAGACCCAGCTGTCCGGG
CCACAGACCCCCAGCAGGTAGCATTCCCCAGCCCTGCCGAGCTCCCGGACCAGAAGCAGC
TGCGCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGG
GGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGAC
CCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCC
CCATCTTCGACTTCAGAGTCTTCTTCCAAG
gtcagtgaggcccttgcctggggggctgtctccaggggtccttgggagcacctgcctgcc
aggtactcagcagagtccccttcttcagagctggtggaattccgggcacggcagcgccgt
ggctccccacgctataccatctacctgggcttcgggcaggacctgtcagctgggaggccc
EXON 8  119 bp
acccccaggctccgccagcccctccaccccagcctgcctgctgcctcggaactgtgacac
ccccatcttcgacttcagagtcttcttccaaggtcagtgaggcccttgcctggggggctg
tctccaggggtccttgggagcacctgcctgccaggtactcagcagagtccccttcttcag
AGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGG
GCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAG
gtgagaccagagcctcaaggaggggaggccatgtgctcaggcccactgacagacgcctga
tgccctcagagcctcggagagggggaggggaggccatacaccgggtcactgacagacgcc
cgacgccctcagagcctggggagggggaggggaggacacacgccgggtcactgacagacg
EXON 9  210 bp
ggaggggaggccatgtgctcaggcccactgacagacgcctgatgccctcagagcctcgga
gagggggaggggaggccatacaccgggtcactgacagacgcccgacgccctcagagcctg
gggagggggaggggaggacacacgccgggtcactgacagacgcccgatccctcctggcag
CTGGAACCCTGGCTGTGCCGAGTGCACCTAGAGGGCACGCAGCGTGAGGGTGTGTCTTCC
CTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATC
GAGTGCTTCCTTATGGAGCTGGAGCAGCCCGCCTAGAACCCAGTCTAATGAGAACTCCAG
AAAGCTGGAGCAGCCCACCTAGAGCTGGCC
gcggccgcccagtctaataaaaagaactccagaacacgtactggcatcttggctggtggg
gaattgggtccaggctgaacacgggtgaggcccagggagggaggggacctccacggcctc
cctgcacaccaactcacttctgtcttcaccacacacatcacagccaagctttgactcaaa