Gene IRF7 Variant 3
DNA : 3.07 KbNT_035113
mRNA : 1634 bp NM_004030
CDS : 1269 bp NP_004021
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  306 bp
ctgggggagcctgagagatgagggtcgggcggggagggaggcggaggcggaggcggaggc
ggggttccgcggagctgagaaccggacggggtgggatcgaggagggtgcgaagcgccact
gtttaggtttcgctttcccgggagcctgacccgcccctgacgtcgcctttcccgtctccg
CAGGGTCCGGCCTGCGCCTTCCCGCCAGGCCTGGACACTGGTTCAACACCTGTGACTTCA
TGTGTGCGCGCCGGCCACACCTGCAGTCACACCTGTAGCCCCCTCTGCCAAGAGATCCAT
ACCGAGGCAGCGTCGGTGGCTACAAGCCCTCAGTCCACACCTGTGGACACCTGTGACACC
TGGCCACACGACCTGTGGCCGCGGCCTGGCGTCTGCTGCGACAGGAGCCCTTACCTCCCC
TGTTATAACACCTGACCGCCACCTAACTGCCCCTGCAGAAGGAGCAATGGCCTTGGCTCC
TGAGAG
gtaagagcccggcccaccctctccagatgccagtccccgagcgccctgcagccggccctg
actctccgcggccgggcacccgcagggcagccccacgcgtgctgttcggagagtggctcc
ttggagagatcagcagcggctgctatgaggggctgcagtggctggacgaggcccgcacct
EXON 2  163 bp
tctgctgcgacaggagcccttacctcccctgttataacacctgaccgccacctaactgcc
cctgcagaaggagcaatggccttggctcctgagaggtaagagcccggcccaccctctcca
gatgccagtccccgagcgccctgcagccggccctgactctccgcggccgggcacccgcag
GGCAGCCCCACGCGTGCTGTTCGGAGAGTGGCTCCTTGGAGAGATCAGCAGCGGCTGCTA
TGAGGGGCTGCAGTGGCTGGACGAGGCCCGCACCTGTTTCCGCGTGCCCTGGAAGCACTT
CGCGCGCAAGGACCTGAGCGAGGCCGACGCGCGCATCTTCAAG
gtggggaccccagccccgccccgccccgggtgggagagcccgcctaggaccccgcgggcc
cggcacacgtgttctgtccccctcttcaggcctgggctgtggcccgcggcaggtggccgc
ctagcagcaggggaggtggcccgccccccgaggctgagactgcggagcgcgccggctgga
EXON 3  211 bp
gtggctggacgaggcccgcacctgtttccgcgtgccctggaagcacttcgcgcgcaagga
cctgagcgaggccgacgcgcgcatcttcaaggtggggaccccagccccgccccgccccgg
gtgggagagcccgcctaggaccccgcgggcccggcacacgtgttctgtccccctcttcag
GCCTGGGCTGTGGCCCGCGGCAGGTGGCCGCCTAGCAGCAGGGGAGGTGGCCCGCCCCCC
GAGGCTGAGACTGCGGAGCGCGCCGGCTGGAAAACCAACTTCCGCTGCGCACTGCGCAGC
ACGCGTCGCTTCGTGATGCTGCGAGATAACTCGGGGGACCCGGCCGACCCGCACAAGGTG
TACGCGCTCAGCCGGGAGCTGTGCTGGCGAG
gtgagcgacgccggctgccaagggcgttggcattcgtcctgcttgggcaaaggggaacat
tctctgggtcagatttgtggttttagaagctgttctgggagaggctgccagcaggcccag
gacaggtggagagccacatccccacctcctcaggccacagcctaagggttcacagccagg
EXON 4  59 bp
ttagaagctgttctgggagaggctgccagcaggcccaggacaggtggagagccacatccc
cacctcctcaggccacagcctaagggttcacagccaggaagctggtgggggctacaccag
gctctccttgtatctctcactctggtgtcggggcctaacgcctgccccattctctctcag
AAGGCCCAGGCACGGACCAGACTGAGGCAGAGGCCCCCGCAGCTGTCCCACCACCACAG
gtacccttctctctgcctgcctctcctcctgccaggccgcggagctgcttacgttcaccc
tgacttttccctgcagggtgggcccccagggccattcctggcacacacacatgctggact
ccaagccccaggccccctccctgccccagctggtgacaagggggacctcctgctccaggc
EXON 5  87 bp
agagggacaagaagggcttcccctgactggggcctgtgctggaggtgtgggcgtgcccgg
ggagggggggagcgcgggaggggccagtgcacctggacggacactttagaagggggctgg
ggattggggagctggagaattaggaggggaccaccgttcccactgtcctcccctcctcag
GCCCAGGGCTCCCTGCTGGGGAGCTGTACGGGTGGGCAGTAGAGACGACCCCCAGCCCCG
GGCCCCAGCCCGCGGCACTAACGACAG
gtgagaggggtaggggttgggaggcctggggcacagggagaggctagggatgaggtgcca
gcacaggattcccttccggatgcaggcgaggccgcggccccagagtccccgcaccaggca
gagccgtacctgtcaccctccccaagcgcctgcaccgcggtgcaaggtgagtgcatccca
EXON 6  81 bp
ctcctcaggcccagggctccctgctggggagctgtacgggtgggcagtagagacgacccc
cagccccgggccccagcccgcggcactaacgacaggtgagaggggtaggggttgggaggc
ctggggcacagggagaggctagggatgaggtgccagcacaggattcccttccggatgcag
GCGAGGCCGCGGCCCCAGAGTCCCCGCACCAGGCAGAGCCGTACCTGTCACCCTCCCCAA
GCGCCTGCACCGCGGTGCAAG
gtgagtgcatcccaggaaggggcagcctgtccccgcccacccccgtcactcacggcttgt
ccccgcccacccatcactcacatcctgtccccgcccacccccgtcactcacatcctgtcc
ccgcccacccccgtcactcacagcctgtccccgcccacccccgtcactcacagcttggtc
EXON 7  390 bp
tcccaggaaggggcagcctgtccccgcccacccccgtcactcacggcttgtccccgccca
cccatcactcacatcctgtccccgcccacccccgtcactcacatcctgtccccgcccacc
cccgtcactcacagcctgtccccgcccacccccgtcactcacagcttggtctccacacag
AGCCCAGCCCAGGGGCGCTGGACGTGACCATCATGTACAAGGGCCGCACGGTGCTGCAGA
AGGTGGTGGGACACCCGAGCTGCACGTTCCTATACGGCCCCCCAGACCCAGCTGTCCGGG
CCACAGACCCCCAGCAGGTAGCATTCCCCAGCCCTGCCGAGCTCCCGGACCAGAAGCAGC
TGCGCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGG
GGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGAC
CCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCC
CCATCTTCGACTTCAGAGTCTTCTTCCAAG
gtcagtgaggcccttgcctggggggctgtctccaggggtccttgggagcacctgcctgcc
aggtactcagcagagtccccttcttcagagctggtggaattccgggcacggcagcgccgt
ggctccccacgctataccatctacctgggcttcgggcaggacctgtcagctgggaggccc
EXON 8  119 bp
acccccaggctccgccagcccctccaccccagcctgcctgctgcctcggaactgtgacac
ccccatcttcgacttcagagtcttcttccaaggtcagtgaggcccttgcctggggggctg
tctccaggggtccttgggagcacctgcctgccaggtactcagcagagtccccttcttcag
AGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGG
GCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAG
gtgagaccagagcctcaaggaggggaggccatgtgctcaggcccactgacagacgcctga
tgccctcagagcctcggagagggggaggggaggccatacaccgggtcactgacagacgcc
cgacgccctcagagcctggggagggggaggggaggacacacgccgggtcactgacagacg
EXON 9  218 bp
ggaggggaggccatgtgctcaggcccactgacagacgcctgatgccctcagagcctcgga
gagggggaggggaggccatacaccgggtcactgacagacgcccgacgccctcagagcctg
gggagggggaggggaggacacacgccgggtcactgacagacgcccgatccctcctggcag
CTGGAACCCTGGCTGTGCCGAGTGCACCTAGAGGGCACGCAGCGTGAGGGTGTGTCTTCC
CTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATC
GAGTGCTTCCTTATGGAGCTGGAGCAGCCCGCCTAGAACCCAGTCTAATGAGAACTCCAG
AAAGCTGGAGCAGCCCACCTAGAGCTGGCCGCGGCCGC
ccagtctaataaaaagaactccagaacacgtactggcatcttggctggtggggaattggg
tccaggctgaacacgggtgaggcccagggagggaggggacctccacggcctccctgcaca
ccaactcacttctgtcttcaccacacacatcacagccaagctttgactcaaagaacaaga