Gene GAS2 Variant 2
DNA : 138.19 KbNT_009237
mRNA : 1987 bp NM_005256
CDS : 942 bp NP_005247
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  206 bp
ttctatttgacctttgattgctgctgttttcctactaagtgtttggccaaaagtgagagg
gccagtacagataaagcaaatagtgtttcatggggttaataattaataaactgaactgtc
atcagaaaacccgcggatccagttcattataatgtcatgatgacaacattttgtgagaga
AGTCTGTATAAAAAGCAATTGCTCTTTTGTTTCCAAAACAGGTATTACAAGTGGATAAAT
AATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGACCTGGCCTCTCTGATATGCATCA
GTATAGCCAATGGCTAGCCAGCAGACATGAAGCTAATTTGCTACCAATGAAAGAAGATCT
GGCCTTGTGGTTAACCAATCTATTAG
gtaaggttataagatctcattttgtgagcaaagacaacagtttttgttttatttttcctc
ctgtagtgtccttcacctaagcatgtgatagcaccttggaaagaaagacttttattattt
gacatttgcatctgggaaacctgaagcaggtggaaaatttaagtgaatttcccaatgtct
EXON 2  122 bp
tcttgcaaccaaaggaagatagaaaattccaaagaaatgactatttctggtaagctccta
tcccagttatgtaactcagctagaatagcaattttagtgataaaactgtgtcaaatattt
tatttagtgtgaatctgacatttgattttccttttataatgcttctttttgttatttcag
GGAAGGAGATTACAGCAGAAACTTTTATGGAGAAGTTGGACAATGGTGCCTTGCTCTGTC
AACTTGCAGAAACTATGCAGGAGAAATTCAAGGAGAGCATGGATGCTAACAAGCCCACAA
AG
gtaaaagatcccaatgcaaaaatcactcttaggtggtagattacatttataattgcttat
aaattgtgtgtaattaaaaaatttattgtgaacggatgcatcaaggtctatactaacaac
aaagtacagagagttctttttaattaggtaacatgttatttgcactctaattacataaat
EXON 3  142 bp
attttcagtcccttactgccaggttaattgcatagcattatatttcctttctagggttct
ttgcaaacctacttattggcatgaggtaattccgaagcattttgttgaaaacatgttttt
aaaacatcattgtgctaactttgacagatttctcctagaacgaatttctttatttttcag
AATCTACCGTTGAAGAAGATCCCATGCAAAACCAGTGCACCCTCGGGCTCCTTTTTTGCC
AGAGACAATACAGCAAATTTCTTATCCTGGTGCCGAGATTTAGGGGTGGATGAAACGTGT
CTATTTGAATCGGAAGGTTTGG
gtatgtattaacttcagaattttagttgataagatacgcaaattatcttttgtctttgtc
agtatagccatcaaaaagttttttgtatgatgtcattttgcagattattagcttaaaaag
tctgagtttgttgaaatcttgcaggtttgctgctaacttgatactttgaaaatagaaaaa
EXON 4  64 bp
ctaatttaagcctttagtagagctagatgtattgaggtatgggatgggttctatgactgt
cagaatgaagactagatcctttcctgggagcacgaggaatgagggtcattggcaagcctg
tgctgttgagctgcttattccttctattgtaaaggtgttcgcctctgtcttgtctttcag
TCCTCCACAAGCAACCCAGAGAAGTGTGTCTCTGTCTGCTAGAGCTTGGCCGGATTGCAG
CCAG
gtaggtcaaaccactgcaactatgtcaagacattgacgatttcagcatccaagcaacaca
gaagcttgctggcttttcattgctaatgtttaacctggatgttgagaagctactcattca
cgatgataatatgaacttcttgagggcagcagttaaccaaattaaaagtgtgccaccaat
EXON 5  142 bp
ttttgcctctgcttagaaggatgctaattcaagagcttacaatttcaatgccagaaaaaa
agtgaatgttatttttaaaagtcagtgatttactcccatggtgctcatcatcacatgtaa
tatatggtaattgtatcattataagttatgcatatgtaatgatccagggtctttttaaag
GTATGGTGTGGAGCCTCCTGGTTTGATAAAGCTGGAAAAAGAGATTGAACAAGAAGAAAC
ACTTTCTGCCCCTTCTCCTTCACCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGTAC
AGGAAACTTACTGGATGATGCA
gtaagtaaaatcagtcagacttcttaccaacggttagtctttcttgcactacaaaacata
ttctgtgcaatctcgtatcagtctaatctttacctatatcaattttcttgaaatgtattt
taagcccatatgaaaaactttgtagtcctacaattcattttgagattcaaaactgaacta
EXON 6  108 bp
ttggggcctgaactttacatggttatgatttaatgtgatattcctatgctcacatgatgt
ccatagataaataacaagtttaaagtcattaagggttcaggggccgtggagtccttggag
caaattaacataaatgcagcctaattaagacaaatgaatgtgcctgctcttctatttcag
GTGAAACGAATTTCTGAAGATCCTCCTTGCAAATGCCCAAACAAGTTCTGTGTGGAGCGG
CTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGG
gtaaagttttacttttcacttatcttgtttttatgggaagattcagaatttgagttaggg
gaaatatgacagataagagcaggaacttccatatggtgcttacgtttaaagatacatggt
atgaatttttttaaagtaacatacattataatgtactactgaaggctaaatacaactgtt
EXON 7  1203 bp
cagaaaaaaaacaggacttctttcatagactatatgctaactcagacattttgcaccaag
tagaaaaacaatgggtcatgaaatacaaaccaaaacactaatttcactagaaccaggggt
tgattcaaggtactgtaagaattctcggaatttaacacttttgatattttttcatttcag
ATGCTGCACAACAAACATGTCATGGTCCGTGTGGGAGGAGGCTGGGAAACTTTTGCAGGG
TATTTGTTGAAACACGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACA
TCCCCTATCCAAAGCAAATCTCCAACTCTAAAGGACATGAATCCAGATAACTACTTGGTG
GTCTCTGCCAGTTATAAGGCTAAGAAGGAAATTAAGTGAAACAAATTGGTCATGACAAGG
GGACCCTCATAATGGCCTGTATCCACTTCTCCAGTATAGTCAGTTTAGTTCATATGTTCT
GAAAACTGTTTTGGAGAAAGATAGACAGAAAAATGTCATCATATTGAAAAATGTTCAAAG
AGTAGCACTATTTATTTTTAATGCTTCTGTAGAATATGACCTATTAAAAGAAAATCTAAA
CTCAAATTTAAATTATCCAAATTTTAGGCAAATTATTATTTCTCAATATGCGAACACAGT
ATTTAGAACACAATATTAGAAACACAATTCTAACTAAAGATAAATAAGGAGAAAACATTT
AGGATTTGCAGATAAGTCAACAGAAAGTGCCTGCTTTACACTCATGAGTAAAAGCACTCC
AGACATTTTTATAATTGCAAGATTTTTATGCTTTTTTTTTTTTTTTTTTACAAAATGATG
ATTAGTGTGATAATGTGCTGCAAAAAATATCCAACAGCACTACACATAAGTACAGAGTAT
TCACAATAGTAATATGTTACTGGAAAGGCCACTTCCGAAAAGTTTACATTCACTTGGAAG
GCTGCCTTAAAGTATATCTCTTATCTATGACCAAATATCTGGGGTACTTTTAGAAGTTTT
CAGTACACCCCCTTAGAGAATAGCTTATGAGTTATTTCACACATTCCTGAGCACATGGCT
GTGTTTAGAATGATCTAGTGTAATTCATACATGAGCTGACATACGTTGATACTTTGACGA
GTAAATTGTACAGTCAAATGTTCATTGATTTCATGTTATTTCAAAGCATTTTCTTATTAA
AAATATATCTTTAGTTAATCCTATTTTGCTATGCTTTCTAGTAAAGTAAATTCACTGTAG
CTAATGATGTTACAGACTTACGTATACCCTTGTATACCTGGGACAGGGCTGTTTTATACC
AATAAACAGCAAAATATTGTCCTTACTCATTCAAGAATTAAAAGGATAAATTTTAAAAAT
GTT
atctgtctctaaatcaatgcctcattctgaaatcaagttaattttcaaatggcaactttc
tccaacagttataagaagaatcaaattagggctccctggcacttcttcactttgggagat
gagtgatggtggtgttagttttccttagcagagagttcaggttttattataagtgctgct