Gene GAS2 Variant 1
DNA : 144.89 KbNT_009237
mRNA : 2174 bp NM_177553
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  228 bp
ctccaaccctctccaacaaggttagatcagttgtgtatgagagatcttatgccaaggaaa
taagatctgcttgtgcacaggaacacccatttgacatcctagtattaaaataaaggctta
gacagtttggatgtaccagcctggcagaggaagtccacttttcctccccacgtatcccct
GAGATTCACAGAGGCAAGGCAGAGAACAAGACCTGTGCTTCTTTACTCCAAACTCTTAGC
AGTGTGGACACTGATTAACTGCAGCTGGGGTCTGATTTGCCCAGCCTGTCTTTGATATTG
ATCAATGAACTCCTTCTCAAGGAATGCTTTCCTCTAACTGCGGTGAAGGTGGTGGCTCTG
GTGGTTCTCTCCAACATGGGTGTCTGGGTTTTGACTGCCTAAGAGAAG
gtaagggacagatggatgaggcatgggacagtgtgcctttgcaaagcacattggagactt
tgcacagggctgcctgaatggtcccttacatggaaaaggtagcttggatttcagcctgaa
tgctactgaagtttgggtttatttcattactttattgctaaacactatgctgtggtgtta
EXON 2  165 bp
tttggccaaaagtgagagggccagtacagataaagcaaatagtgtttcatggggttaata
attaataaactgaactgtcatcagaaaacccgcggatccagttcattataatgtcatgat
gacaacattttgtgagagaagtctgtataaaaagcaattgctcttttgtttccaaaacag
GTATTACAAGTGGATAAATAATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGACCTG
GCCTCTCTGATATGCATCAGTATAGCCAATGGCTAGCCAGCAGACATGAAGCTAATTTGC
TACCAATGAAAGAAGATCTGGCCTTGTGGTTAACCAATCTATTAG
gtaaggttataagatctcattttgtgagcaaagacaacagtttttgttttatttttcctc
ctgtagtgtccttcacctaagcatgtgatagcaccttggaaagaaagacttttattattt
gacatttgcatctgggaaacctgaagcaggtggaaaatttaagtgaatttcccaatgtct
EXON 3  122 bp
tcttgcaaccaaaggaagatagaaaattccaaagaaatgactatttctggtaagctccta
tcccagttatgtaactcagctagaatagcaattttagtgataaaactgtgtcaaatattt
tatttagtgtgaatctgacatttgattttccttttataatgcttctttttgttatttcag
GGAAGGAGATTACAGCAGAAACTTTTATGGAGAAGTTGGACAATGGTGCCTTGCTCTGTC
AACTTGCAGAAACTATGCAGGAGAAATTCAAGGAGAGCATGGATGCTAACAAGCCCACAA
AG
gtaaaagatcccaatgcaaaaatcactcttaggtggtagattacatttataattgcttat
aaattgtgtgtaattaaaaaatttattgtgaacggatgcatcaaggtctatactaacaac
aaagtacagagagttctttttaattaggtaacatgttatttgcactctaattacataaat
EXON 4  142 bp
attttcagtcccttactgccaggttaattgcatagcattatatttcctttctagggttct
ttgcaaacctacttattggcatgaggtaattccgaagcattttgttgaaaacatgttttt
aaaacatcattgtgctaactttgacagatttctcctagaacgaatttctttatttttcag
AATCTACCGTTGAAGAAGATCCCATGCAAAACCAGTGCACCCTCGGGCTCCTTTTTTGCC
AGAGACAATACAGCAAATTTCTTATCCTGGTGCCGAGATTTAGGGGTGGATGAAACGTGT
CTATTTGAATCGGAAGGTTTGG
gtatgtattaacttcagaattttagttgataagatacgcaaattatcttttgtctttgtc
agtatagccatcaaaaagttttttgtatgatgtcattttgcagattattagcttaaaaag
tctgagtttgttgaaatcttgcaggtttgctgctaacttgatactttgaaaatagaaaaa
EXON 5  64 bp
ctaatttaagcctttagtagagctagatgtattgaggtatgggatgggttctatgactgt
cagaatgaagactagatcctttcctgggagcacgaggaatgagggtcattggcaagcctg
tgctgttgagctgcttattccttctattgtaaaggtgttcgcctctgtcttgtctttcag
TCCTCCACAAGCAACCCAGAGAAGTGTGTCTCTGTCTGCTAGAGCTTGGCCGGATTGCAG
CCAG
gtaggtcaaaccactgcaactatgtcaagacattgacgatttcagcatccaagcaacaca
gaagcttgctggcttttcattgctaatgtttaacctggatgttgagaagctactcattca
cgatgataatatgaacttcttgagggcagcagttaaccaaattaaaagtgtgccaccaat
EXON 6  142 bp
ttttgcctctgcttagaaggatgctaattcaagagcttacaatttcaatgccagaaaaaa
agtgaatgttatttttaaaagtcagtgatttactcccatggtgctcatcatcacatgtaa
tatatggtaattgtatcattataagttatgcatatgtaatgatccagggtctttttaaag
GTATGGTGTGGAGCCTCCTGGTTTGATAAAGCTGGAAAAAGAGATTGAACAAGAAGAAAC
ACTTTCTGCCCCTTCTCCTTCACCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGTAC
AGGAAACTTACTGGATGATGCA
gtaagtaaaatcagtcagacttcttaccaacggttagtctttcttgcactacaaaacata
ttctgtgcaatctcgtatcagtctaatctttacctatatcaattttcttgaaatgtattt
taagcccatatgaaaaactttgtagtcctacaattcattttgagattcaaaactgaacta
EXON 7  108 bp
ttggggcctgaactttacatggttatgatttaatgtgatattcctatgctcacatgatgt
ccatagataaataacaagtttaaagtcattaagggttcaggggccgtggagtccttggag
caaattaacataaatgcagcctaattaagacaaatgaatgtgcctgctcttctatttcag
GTGAAACGAATTTCTGAAGATCCTCCTTGCAAATGCCCAAACAAGTTCTGTGTGGAGCGG
CTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGG
gtaaagttttacttttcacttatcttgtttttatgggaagattcagaatttgagttaggg
gaaatatgacagataagagcaggaacttccatatggtgcttacgtttaaagatacatggt
atgaatttttttaaagtaacatacattataatgtactactgaaggctaaatacaactgtt
EXON 8  1203 bp
cagaaaaaaaacaggacttctttcatagactatatgctaactcagacattttgcaccaag
tagaaaaacaatgggtcatgaaatacaaaccaaaacactaatttcactagaaccaggggt
tgattcaaggtactgtaagaattctcggaatttaacacttttgatattttttcatttcag
ATGCTGCACAACAAACATGTCATGGTCCGTGTGGGAGGAGGCTGGGAAACTTTTGCAGGG
TATTTGTTGAAACACGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACA
TCCCCTATCCAAAGCAAATCTCCAACTCTAAAGGACATGAATCCAGATAACTACTTGGTG
GTCTCTGCCAGTTATAAGGCTAAGAAGGAAATTAAGTGAAACAAATTGGTCATGACAAGG
GGACCCTCATAATGGCCTGTATCCACTTCTCCAGTATAGTCAGTTTAGTTCATATGTTCT
GAAAACTGTTTTGGAGAAAGATAGACAGAAAAATGTCATCATATTGAAAAATGTTCAAAG
AGTAGCACTATTTATTTTTAATGCTTCTGTAGAATATGACCTATTAAAAGAAAATCTAAA
CTCAAATTTAAATTATCCAAATTTTAGGCAAATTATTATTTCTCAATATGCGAACACAGT
ATTTAGAACACAATATTAGAAACACAATTCTAACTAAAGATAAATAAGGAGAAAACATTT
AGGATTTGCAGATAAGTCAACAGAAAGTGCCTGCTTTACACTCATGAGTAAAAGCACTCC
AGACATTTTTATAATTGCAAGATTTTTATGCTTTTTTTTTTTTTTTTTTACAAAATGATG
ATTAGTGTGATAATGTGCTGCAAAAAATATCCAACAGCACTACACATAAGTACAGAGTAT
TCACAATAGTAATATGTTACTGGAAAGGCCACTTCCGAAAAGTTTACATTCACTTGGAAG
GCTGCCTTAAAGTATATCTCTTATCTATGACCAAATATCTGGGGTACTTTTAGAAGTTTT
CAGTACACCCCCTTAGAGAATAGCTTATGAGTTATTTCACACATTCCTGAGCACATGGCT
GTGTTTAGAATGATCTAGTGTAATTCATACATGAGCTGACATACGTTGATACTTTGACGA
GTAAATTGTACAGTCAAATGTTCATTGATTTCATGTTATTTCAAAGCATTTTCTTATTAA
AAATATATCTTTAGTTAATCCTATTTTGCTATGCTTTCTAGTAAAGTAAATTCACTGTAG
CTAATGATGTTACAGACTTACGTATACCCTTGTATACCTGGGACAGGGCTGTTTTATACC
AATAAACAGCAAAATATTGTCCTTACTCATTCAAGAATTAAAAGGATAAATTTTAAAAAT
GTT
atctgtctctaaatcaatgcctcattctgaaatcaagttaattttcaaatggcaactttc
tccaacagttataagaagaatcaaattagggctccctggcacttcttcactttgggagat
gagtgatggtggtgttagttttccttagcagagagttcaggttttattataagtgctgct