Gene FXYD2 Variant 2
DNA : 4.64 KbNT_033899
mRNA : 546 bp NM_001680
CDS : 201 bp NP_001671
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  66 bp
cctccctgcccctgcctccccacgcacgtcctcaccctgcagaaggagcccctccatcca
cactgcagcttttcttgtgaccagggtaaatattacctggcactgttaatgtttaatgcc
cgcacctcgtccccggccaccccgtggaggcagccagacactctccaaaaagcagagaca
GCAGGAAGAGGGGAGTGGAGGCAGCCCATTCACCTGGGGAAATGACTGGGTTGTCGATGG
ACGGTG
gtgagtgtgctggtgtgcgtgcccgggcgtgtgcaatgctgggtggctctgattggcctg
cctttgtggggtcagctggaccctactcttccctctcctgccacctcagccttccagagt
acccagcccctcttcctgtcggcctcctctctaagaaaatttgcaacttaaaggaggacc
EXON 2  39 bp
agccgcctggagcagaagcctgctggcaatggttttagcaacacccctgctcccagcctc
ccctcgcctgcttggaccctcgagggtcctctgggaagggaaggacagggaattccagct
gttcctgtggctggctcaccatcggtgactcctctcatcccacctctggctctctcctag
GCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATG
gtaagcctgggcccctgcgcacccttcctgagccctcaggaccccttccaccaagcagcg
gcctctcccagccccaggtccatgctctgtgccccttatctcccctggttaccacgggct
gctgcgggcaggctgcggagagagacagctgctgggagagaccacccatcccgctcctct
EXON 3  75 bp
gcacccttcctgagccctcaggaccccttccaccaagcagcggcctctcccagccccagg
tccatgctctgtgccccttatctcccctggttaccacgggctgctgcgggcaggctgcgg
agagagacagctgctgggagagaccacccatcccgctcctcttgccctctctttccggag
ACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGC
TCCTCATCCTCCTCA
gtaagtggggtggcctccagggaaggggtgctgaccagggcacctctcttctcaaggccg
ctgagcaggctggctttcgggagttgccaagggaggggtgagcctccccaccacgccccc
cactgcaggatgtgggaatgggtgcccggtggggtgccaggctcgctgggagcacagtgt
EXON 4  37 bp
caaaaaataaaataaaataaaatataaaataaaatagagacagtcaaacgtggcctccaa
gcctgaccctgcgatgatactggcaggagggaggtaggagagactggaagaattttgagt
cttccagggtctccttggaaaattagtccatggaaacaaatctccttttctcttttcaag
GCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAG
gtgagcgctgcctggggtgaccgatgagggggttggggctggagaaggaggggcgggctg
aggattttgtctctgacacagtggaggatccccagcctcagagatccctagacccacccc
tccccctgccctctcacctgttgcttttccttcccccaccaggcaaatcaatgaagatga
EXON 5  31 bp
gggcaataagaagcgcaggtgagcgctgcctggggtgaccgatgagggggttggggctgg
agaaggaggggcgggctgaggattttgtctctgacacagtggaggatccccagcctcaga
gatccctagacccacccctccccctgccctctcacctgttgcttttccttcccccaccag
GCAAATCAATGAAGATGAGCCGTAACAGCAG
gtatgctaggagggcctggggaaggtgcggggagggcagggcaggcttgggagcaacagg
gaagaattctggctcctggactcggtaaataagaattttagggtcgtccacacatcagcc
aggtggtctgtcacccatcgtgtgtttaaaatgatggccaagggcctggcgtggagtgtg
EXON 6  298 bp
atcagccaggtggtctgtcacccatcgtgtgtttaaaatgatggccaagggcctggcgtg
gagtgtgtgccgcaggagatcacagaggagccctggagaaaagtgagatggacaaggggg
aagtaaaaccccaacctctgctgcctcccacccaaccccatcctgcctttgtcttctcag
CCTCGGCGGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTC
TGGCGCCTCCCCTTCTTCCCTGGGCTTTAGACCTTTGTCCCCGTCACTGCCAGCGCTTGG
GCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATCGCCAACTCCTGCCTCGT
GCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCTCACCTGCCTGC
CTGTCTCCCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGTACAAATACAGCCGGG
tctcatttgttttttcaattaattgctcaggcacctgtctgcctgtaaaagcaagaagtt
cagtgttgtcatctgtaggccactcctcacaccccttgaactggcagaagccctggggac
agaggcctcagcctggcttttatacacctgggaagtctgaaaggcccagaggtcaaaacc