Gene FOLH1 Variant 1
DNA : 62.03 KbNT_009237
mRNA : 2634 bp NM_004476
CDS : 2253 bp NP_004467
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  379 bp
ctttttctgctctgcttttattcagtagagtattgtagagattgtatagaatttcagagt
tgaataaaagttcctcataattataggagtggagagaggagagtctctttcttcctttca
tttttatatttaagcaagagctggacattttccaagaaagtttttttttttaaggcgcct
CTCAAAAGGGGCCGGATTTCCTTCTCCTGGAGGCAGATGTTGCCTCTCTCTCTCGCTCGG
ATTGGTTCAGTGCACTCTAGAAACACTGCTGTGGTGGAGAAACTGGACCCCAGGTCTGGA
GCGAATTCCAGCCTGCAGGGCTGATAAGCGAGGCATTAGTGAGATTGAGAGAGACTTTAC
CCCGCCGTGGTGGTTGGAGGGCGCGCAGTAGAGCAGCAGCACAGGCGCGGGTCCCGGGAG
GCCGGCTCTGCTCGCGCCGAGATGTGGAATCTCCTTCACGAAACCGACTCGGCTGTGGCC
ACCGCGCGCCGCCCGCGCTGGCTGTGCGCTGGGGCGCTGGTGCTGGCGGGTGGCTTCTTT
CTCCTCGGCTTCCTCTTCG
gtaggggggcgcctcgcggagcaaacctcggagtcttccccgtggtgccgcggtgctggg
actcgcgggtcagctgccgagtgggatcctgttgctggtcttccccaggggcggcgatta
gggtcggggtaatgtggggtgagcacccctcgagttaggaggagggtagctgggaacggt
EXON 2  106 bp
tttgcatgactctttttcagtgaaagtaggcaagagaaattaaaattcagaaatatctca
cctaatgtcagaggtaatattgataatttgtgttttacaaataatacatacaacaataat
gaaaaataagtcctatctataggctcgtatctcatgcctatttttggatgtatttttcag
GGTGGTTTATAAAATCCTCCAATGAAGCTACTAACATTACTCCAAAGCATAATATGAAAG
CATTTTTGGATGAATTGAAAGCTGAGAACATCAAGAAGTTCTTATA
gtaagtacatcctcgaaagtttatatggacaagttgttagaaaaatttatcattctgttt
tggtccaatattttatatataggaactggacttttttcttaaaattttatttattaaaga
tcttggatcacatttcatctgaggaggactatactttcagctaaattttgtcattacaga
EXON 3  187 bp
agagcataaaaatttcaaagcagactttgaaaatctatttcatgcaataatactaccact
ttaattttttaacgtatcacacttcaaagtacttttgtgtaactctgctttactttgttg
atttggaataaaagttgattaaacattaatatctaaccactttcaatttttgttcaccag
TAATTTTACACAGATACCACATTTAGCAGGAACAGAACAAAACTTTCAGCTTGCAAAGCA
AATTCAATCCCAGTGGAAAGAATTTGGCCTGGATTCTGTTGAGCTAGCACATTATGATGT
CCTGTTGTCCTACCCAAATAAGACTCATCCCAACTACATCTCAATAATTAATGAAGATGG
AAATGAG
gtaaaaaataaataaataaataaaagaaacattccccccatttattctttttcaaatacc
ttctatgaaataatgttctatcccatctctaaatattaatagaaatcaatattattggat
cttgtgaatacctttaatatctcattatccgtgtcaactactttcctatgatgtttgagt
EXON 4  102 bp
catctcgtgaattcttcacaacttctagcatagtgctgggtatctgatactatcatcaaa
atcctgaaggattcattcaccctctactgacataaaagataatattcattttttttgtgt
ttgattacagtaatcaaactttaactgttttattttgattataatattttgtttctctag
ATTTTCAACACATCATTATTTGAACCACCTCCTCCAGGATATGAAAATGTTTCGGATATT
GTACCACCTTTCAGTGCTTTCTCTCCTCAAGGAATGCCAGAG
gtaaaaacacagtgcaacaaataaaaatgacaaaaagaagccttccttctcttcatatgt
tcagccgataattaaagggtcataaagggacttttaatgtaatccaattcatttttccac
atttaagtaatgagaatgtcttagtaagaagaaggaatattgattatattttattaatgg
EXON 5  126 bp
aattccattctcaatttaaattcatttttcccttgaatctcttctttggagctcatgcat
ttctgaccttcctgtgtgctctgacctcttccctctttcaaaaatgtccaacagtcccca
tgcagaaaaacctccttgttttatatctgactcatattaagtcattcccgatctcaacag
GGCGATCTAGTGTATGTTAACTATGCACGAACTGAAGACTTCTTTAAATTGGAACGGGAC
ATGAAAATCAATTGCTCTGGGAAAATTGTAATTGCCAGATATGGGAAAGTTTTCAGAGGA
AATAAG
gtaaggtaaaaattatctctttttttctctcccccaatgtaaaaagttatagtgggtttt
acatgtgtagaatcattttcttaaaactttatgaataccattattttcttgtattctgtg
acatgcccaccttacagagaggacacatttactaggttatatcccggggttaaattcgag
EXON 6  187 bp
agcttatagtagcaaaaagaaaagggaaattctatccgagatgtcctttgttgtaggcct
aatgagaaaaggttgaagataaagttctggtactcatttaagtgtaatattgaaaattga
tattaccgaatctggaacaaccaatttaaaataaggaaagaaagacactgtgttttctag
GTTAAAAATGCCCAGCTGGCAGGGGCCAAAGGAGTCATTCTCTACTCCGACCCTGCTGAC
TACTTTGCTCCTGGGGTGAAGTCCTATCCAGATGGTTGGAATCTTCCTGGAGGTGGTGTC
CAGCGTGGAAATATCCTAAATCTGAATGGTGCAGGAGACCCTCTCACACCAGGTTACCCA
GCAAATG
gtgaatgatcaatccttgaatatcataggaaacttaacatttgaaagagactttattaaa
gaatttcctttggtacaatggactaagcatgtctttttttattctctttgcatttaagaa
tgaaagaattttgaactctaaagtgattggttcaggccccttacccccttattttgaaac
EXON 7  94 bp
tcacaagcaatgtatgaggatttcagttgctctgcattctcgctaacatttgaattgtta
atctgttttactttaacaattctagcaaatgtgaaattagaatgtatttaatgtgattta
tagagaaccgtttgaatgaaactgagtttttactggaaatatggcaattttttttttcag
AATATGCTTATAGGCGTGGAATTGCAGAGGCTGTTGGTCTTCCAAGTATTCCTGTTCATC
CAATTGGATACTATGATGCACAGAAGCTCCTAGA
gtaagtttgtaagaaaccatggatggctatttgggtaattttcttattgacagttttcaa
atgttaggcttttatctccattttttagtacttaaattttccaacatgggtgttgcttgt
aattttatcagtataaaatagaagagtggttctgttctggaatttagtatatacatgagt
EXON 8  99 bp
gaagtggaggtagcaattcctcagaattatggtaaggtttaaatgacgtattatattcaa
agcactttgcactcattaaagatattatgagcagatgctcaataaagtgaatccattaac
attttaatgcgttacttcaaggtttttttgtggctaataatgtttttttgtgtccaatag
AAAAATGGGTGGCTCAGCACCACCAGATAGCAGCTGGAGAGGAAGTCTCAAAGTGCCCTA
CAATGTTGGACCTGGCTTTACTGGAAACTTTTCTACACA
gttaagagactattttaattttaactcttttaagggggagacttaaagaaaaaaatacta
tagaggatgacagaaaaagtaaaatttatgtaataccagcaggaaacaaaactgcaagtt
agaaccagtgtaatttttgcctgtgaacaattagaaatctttaagcaagattgaagattt
EXON 9  86 bp
ggctcctgtatacactggtgtgttagtaagtttgtatgccttttctcctgttaatcagtt
ttcagtttattttaccagacttgaaccttcaaaggcagaggggaaaattcccttaaacct
tatagtgttaatctgttaaccagtttttttttttaagaatgtcttttatttttgcattag
AAAAGTCAAGATGCACATCCACTCTACCAATGAAGTGACAAGAATTTACAATGTGATAGG
TACTCTCAGAGGAGCAGTGGAACCAG
gtaaaggaatcgtttgcttagcaaatattgatcaagtaactgttatgtgctggatactac
caagctctgggagtgcaaagtgaatcaaaacaaacaaacaaacaaacaaacgaagaaaat
cggtggaactcacctaaaaacaaaggaaataagtatgaaataattttgtattgtggtaca
EXON 10  120 bp
tcagatagaagaaacacatattaaaatcagaaataacatattttcacaaatcttggggaa
cctagccttttttttttttctgaggcgtgagtgctttgtatttagatgctattgagtcat
ttgcaattttctcttttattgacctgaaatgacaaataatcttgtatctatgctttctag
ACAGATATGTCATTCTGGGAGGTCACCGGGACTCATGGGTGTTTGGTGGTATTGACCCTC
AGAGTGGAGCAGCTGTTGTTCATGAAATTGTGAGGAGCTTTGGAACACTGAAAAAGGAAG

gtaatacaaacaaacagcaagaaaaaaaacagcctatctgagtctcagtttagtcttctg
taaagggagtataaaaatactacctcaaccattacatgtgtttggtaaaaatactaatac
aattttcagtgttggttggttaattatattgtttatttatttttgcatttatttatataa
EXON 11  83 bp
ttgtattgacaactttaaaatcttacaaaaaaagttacgtaagtaaagattttttactac
aatttgcccttcccaaaccatcaatgacttttttttttttttttccaatctgggcttggt
agtgtcctgggtatattatgaattttttttctatcatttatatatacacatacattttag
GGTGGAGACCTAGAAGAACAATTTTGTTTGCAAGCTGGGATGCAGAAGAATTTGGTCTTC
TTGGTTCTACTGAGTGGGCAGAG
gttagttggtaatttgctataatataaatttttataaaataaagtagccaggacttattt
gccaagcacataaaaataagaagtgaatataatgagaaagtattcaaagttttttcccca
aaatctgaagtaacatattcttgttcaaaaatcagcaataaaaatctctgttgctaaaga
EXON 12  64 bp
agtaatctttattgaaattctttcaaagcagctcttttatgagaatttcttatgtcaaat
ttgtcgttaatatgggtcagctcaattagaaatctacatacattaaatgtagatgtgcat
tttgtgggggagggggagtgggttataactttatatttatagttttcctttttattatag
GAGAATTCAAGACTCCTTCAAGAGCGTGGCGTGGCTTATATTAATGCTGACTCATCTATA
GAAG
gtgaatatcgttggtctcataagaaaagatgtgattaaactaggagcagcagtctagtta
ataaattatgcactaacaaggaaggctatgcattaatgtgtggttagggaatctactgca
acctctgacaggaagcagtgtatgaaccctagttgagagttgggtgagccctaggtgaac
EXON 13  68 bp
cagtgtgggccatggtgagaatgatggactttacagagttagttgggaagccattggaga
gttacagttgaaatcaggttttaaaacaatcattctggtaggaatttagcagtggtcttt
gaagaaaataataacagaaagaaattaaattttaaaatctattcttttcttatttttcag
GAAACTACACTCTGAGAGTTGATTGTACACCGCTGATGTACAGCTTGGTACACAACCTAA
CAAAAGAG
gtatataattacatataatttaagaaaacccaaattctacaaatgatgttttcttgaggt
attatgttaaacataggtggtgttttataacttcttgtcttcatttcatataacatatat
gacatcacatcttcacagaccatcacatctagtaaactgtttacacagattgcctcattt
EXON 14  92 bp
atcacatgagtattttcccacttgtcagaaacttataattcttgatgactgctaatgtat
ggatagcatcccttgtttttgctgaattgtggcttagttactcacttctggttaatggac
atctagtttttaatatatctgatttgtaagtattctctttttttcttttaatttgtgtag
CTGAAAAGCCCTGATGAAGGCTTTGAAGGCAAATCTCTTTATGAAAGTTGGACTAAAAAA
AGTCCTTCCCCAGAGTTCAGTGGCATGCCCAG
gtaaacaaatgaatgaagtttccactgaattcagtgtgggattgttttgaaaataaaagc
acattttctttcaatcattaagtgaaaaattaagtttcaaaatggtctaaaatctgataa
agaaaagcattactttggttcacaaataaaatattactatgtgttttgtagttaaatctg
EXON 15  91 bp
tagaaggagatattttgtgatcaaaattaatattcttttcatgtttttgctgcatgtcta
aagctgtatgtttaaaattacatttataatagtaagaatggggtttagtttaatggacat
gtaatctgtgcttaatgaacaaattactttgaaataattctgttgttttatctctaaaag
GATAAGCAAATTGGGATCTGGAAATGATTTTGAGGTGTTCTTCCAACGACTTGGAATTGC
TTCAGGCAGAGCACGGTATACTAAAAATTGG
gtaagtgaatctcaaattatctaagattatttatgaatatgttttaactaaacaaataat
tctgactccaaaaagtgactcaagcattagaggaatagagaaatttgaaagcagagggag
aagtctcaatggttgacagtatcactactacgtaggataactcctatatcttgtattcca
EXON 16  265 bp
aagcctggaatgtgtttatgtatcataatattagccatttaggatgtagcttattgagat
gcttaagtactttccttgatccatcactgaccaatcttactaatactaatagtaaatatg
gtgctaatcattttttgtaagctatcctataagagatatgttttgttgttttttctgtag
GAAACAAACAAATTCAGCGGCTATCCACTGTATCACAGTGTCTATGAAACATATGAGTTG
GTGGAAAAGTTTTATGATCCAATGTTTAAATATCACCTCACTGTGGCCCAGGTTCGAGGA
GGGATGGTGTTTGAGCTAGCCAATTCCATAGTGCTCCCTTTTGATTGTCGAGATTATGCT
GTAGTTTTAAGAAAGTATGCTGACAAAATCTACAGTATTTCTATGAAACATCCACAGGAA
ATGAAGACATACAGTGTATCATTTG
gtatgttacccttcctttttcaaattcctcatctgtatggttctattaatctcctaaata
taatgggctatcttaggtcatttattatttattgctatttcaagtgatccaatattctgt
ttatgtctataaatgtattttccattttatggatgctcacgtcttataatataaaaatat
EXON 17  82 bp
ttatgtctataaatgtattttccattttatggatgctcacgtcttataatataaaaatat
aaataccttgtaaaacacaaaagatgatggcttctatattgttccttttcttgaactata
gagcagtgccattagaaattatgttctttaagcatttgatgatcccaatttctatttcag
ATTCACTTTTTTCTGCAGTAAAGAATTTTACAGAAATTGCTTCCAAGTTCAGTGAGAGAC
TCCAGGACTTTGACAAAAGCAA
gtatgttctacatatatgtgcatatgtgtgtatgtgtgtgtatatatatatatttaaaag
taaactaacatgactgttgctgaactagctttgggaatttcttgctgttttctttttttt
aaatttgttttactttaagttgctggatacatggacagaacgtgcaggtttgttacatag
EXON 18  93 bp
cgacttttcacatacatgtgtcctccttgcaggacttgagtatgcacaaattttggtgta
gagggtggtcctgaaaccaatccccggagataactaaattcagttttgttctgaaatttt
tattttctgagtagaaacatattttcatgaagttataattatattcattttctttctcag
CCCAATAGTATTAAGAATGATGAATGATCAACTCATGTTTCTGGAAAGAGCATTTATTGA
TCCATTAGGGTTACCAGACAGGCCTTTTTATAG
gtaagaaaagaaaatatgactcctttctgtaatatcactttttcttctaattatttttat
ttttttcactgtggaaaaaatattgtagttgatttcttgcaagcaaatagaaaatttcaa
aatatatgtagtaagtgatagttgtattgtttcttcatataatgtaatatgatttttgca
EXON 19  310 bp
attaattactatagatttcatataatagtcttcagagatgattgaacttggaagttcagt
tgacaagtggcttgttcaaattgttataggaatatgcaatccaggaattgcagagtgctc
ttgtgtttctcttgtatatcatttgggcacctaataaacagcaaacgattttatcaacag
GCATGTCATCTATGCTCCAAGCAGCCACAACAAGTATGCAGGGGAGTCATTCCCAGGAAT
TTATGATGCTCTGTTTGATATTGAAAGCAAAGTGGACCCTTCCAAGGCCTGGGGAGAAGT
GAAGAGACAGATTTATGTTGCAGCCTTCACAGTGCAGGCAGCTGCAGAGACTTTGAGTGA
AGTAGCCTAAGAGGATTCTTTAGAGAATCCGTATTGAATTTGTGTGGTATGTCACTCAGA
AAGAATCGTAATGGGTATATTGATAAATTTTAAAATTGGTATATTTGAAATAAAGTTGAA
TATTATATAT
agttatgtgagtgtttatatatgtgtgtgtttatattgtttatcttctccctatggatta
aaactgaatttcataattataagaggttattctgaagtggaaaaatttaactcagtatta
aatctaaggagaatggcctaatatagtaaaactctcatctggcattatcagggaatcaag