Gene FGF3 Variant 1
DNA : 9.21 KbNT_078088
mRNA : 1548 bp NM_005247
CDS : 720 bp NP_005238
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  711 bp
gacttccccgcaagttgttttcacggacatcagtcatcggcggcggccccattgtgcagg
gggattgatggggagcgggagggggtgacagggcctggggcggcctcctcaaggcctcgg
tctataattttcggaggcataattggtctgggggagggggcgggggaggggcgggtaggg
GACCTTTCAGAGCCAGGAGGGCTTTCGGGGGCGTGGGGCGCGCTGCGGAGCGGAGCCGCG
GCTCGACGGCGGTGCGCTGGCGGCGAGTGTATGCAGACGGCGCCCGGCCCGAACCCCGAG
CCCCGCGGGGCTCCCCACCCGCCGGCCTCCCGCCCCTCCCGCGCCTCCGCCTGGGGACCA
CGTCGGCCTTTTGTTGGCGAACCGTCCTTTCTTTCAGCGCTTTGCGCAGCAACGGAAATT
TCATTGCTCCTGGGTGGAAATTAAAGGGACTCGCGTTCCCTCTCTCCCTCTCCCTCTCCC
ACTCTCCCTCTCTTTCTCTCTCTCGCCCACCCTTCCCCCTTCTTCCCCCACCTTTCCCGC
GAAGCCGGAGTCAGCATCTCCAGGCGCGGGATCCCGCTCCGAGCACCTCGCAGCTGTCCG
GCTGCCGCCCCTTCCATGGGCGCCGCGCTCGCCTGCAGCCGCCGCCGCCGCGGGGCGGGC
GCGATGCCACGATGGGCCTAATCTGGCTGCTACTGCTCAGCCTGCTGGAGCCCGGCTGGC
CCGCAGCGGGCCCTGGGGCGCGGTTGCGGCGCGATGCGGGCGGCCGTGGCGGCGTCTACG
AGCACCTTGGCGGGGCGCCCCGGCGCCGCAAGCTCTACTGCGCCACGAAGTACCACCTCC
AGCTGCACCCGAGCGGCCGCGTCAACGGCAGCCTGGAGAACAGCGCCTACA
gtgagtgccggacgctgcggggccccgggggaagcggcgccgggaggggtcgggcccggg
agaaggcgcgctgcggggccccgcgggggaggcggcgccggggaggggtctggcccggga
gaaggcatggtgcgcccggggtgtccgggaaaagaccgtctgcctcccgctgccagaagg
EXON 2  104 bp
tctctacctcctgtccggtgacttctcccttcctgaacttccactcactccccgacctgt
ggggtgtgtgctaccctccccagccctgagcccggggtgtggctttgggcagggccagct
gggcctcagccgccccctccgtgggggcggcgggagtgaggcacctctcatttcttctag
GTATTTTGGAGATAACGGCAGTGGAGGTGGGCATTGTGGCCATCAGGGGTCTCTTCTCCG
GGCGGTACCTGGCCATGAACAAGAGGGGACGACTCTATGCTTCG
gtgagtccaggctgtcacgtgggtgggcgctgacggagtagcggtctggcctgcacatca
agccaggggacgggggatgtgggcagtagaatgctttgccaagggtacacgggacccaag
ctaggaccagaccctggcccagggctccacgcccagtgatctttggctgtgtctgttaga
EXON 3  733 bp
ggaaggacatgctgggcagagggcagggcctaggcaaaggtgtgactggctgagagtgcg
ctggggtttggcactggaccgaacagcctcacaggaggggagggaggcatcaggcaaccc
tgggccctgacgctgccacagtctccccggggcactgaccatgatatctcatccccgcag
GAGCACTACAGCGCCGAGTGCGAGTTTGTGGAGCGGATCCACGAGCTGGGCTATAATACG
TATGCCTCCCGGCTGTACCGGACGGTGTCTAGTACGCCTGGGGCCCGCCGGCAGCCCAGC
GCCGAGAGACTGTGGTACGTGTCTGTGAACGGCAAGGGCCGGCCCCGCAGGGGCTTCAAG
ACCCGCCGCACACAGAAGTCCTCCCTGTTCCTGCCCCGCGTGCTGGACCACAGGGACCAC
GAGATGGTGCGGCAGCTACAGAGTGGGCTGCCCAGACCCCCTGGTAAGGGGGTCCAGCCC
CGACGGCGGCGGCAGAAGCAGAGCCCGGATAACCTGGAGCCCTCTCACGTTCAGGCTTCG
AGACTGGGCTCCCAGCTGGAGGCCAGTGCGCACTAGCTGGGCCTGGTGGCCACCGCCAGA
GCTCCTGGCGACATCTTGGCGTGGCAGCCTCTTGACTCTGACTCTCCTCCTTGAGCCCTT
GCCCCTGCGTCCCGCGTCTGGGTTCTCAGCTATTTCCAGAGCCAGCTCAAATCAGGGTCC
AGTGGGAACTGAAGAGGGCCCAAGTCGGAGCTCGGAGGGGGCTGCCTGCAATGCAGGGCA
TTTGTGGGTCTGTGTGGCAGGAAGCCGGCAGGGAAGGGCCTGAGTGCCAGCCCTGGCAGA
CTGAGGAGCCTCCCAGGAGCAGCGGGGCAGTGTGGGGCTTTGTGTCATCACAACATTAAA
GTATTTTATTCTA
ctctgtcgtttggtagaccgtgatgcaggctgaggagcgcttgccgcctttactggaacg
tgcttgcttccagcacagcagaatccgcgctggcatcagcctgcgtcagctgctgcttta
agaggaagacggcattcccagaaatcgggctaaaggtgcatttcagttccctggttttag