Gene EHF Variant 2
DNA : 39.72 KbNT_009237
mRNA : 2853 bp NM_172233
CDS : 834 bp NP_758433
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  155 bp
acctgttttgtttgaacactaacgtgtgagttggccaaatgcaaatgagccagtgtttgt
aatcctttattttatttttttaaagggctgggtagccaatcagaagagggggaagtgact
tagggaattcccggttggtggcttattgcttaacatcctacaaaatgatttaaaattatt
GTTATATGCATTTATCTTCACTCTGATGAGGGCTCAGACTTGATAACACCCGTGGTGCCC
CATCCCTATAGGAGCTGGTGAGATTGCAGCCTGCTGCCTCCCCTCCAACAGCCACAGCTA
TTGGATTTCCCACCCAGAATCTTTAGGTAAATGAG
gtaagtcctgatttttaaaacttcttttgaatctggaatccaaacacttgagtggaaaga
gaagcctgctttaaactggacagatgaaactagaacagactcttggagacggctggcagg
aagtgaagctcaccttacctgggcttacctcactgggtcaaatcagaattttattttgga
EXON 2  100 bp
gaaatttttaattgctgtgagttttgcttttacaaaaaacgctttggcaatgggtggcag
gcaatgggtggaaggacaaattctctttattttcttcctaaatttactctgtgatctgca
ctttccaatgacatttgtccaagaggcactgactgaacaggctgtttgatcccctaacag
ATCATGATTCTGGAAGGAGGTGGTGTAATGAATCTCAACCCCGGCAACAACCTCCTTCAC
CAGCCGCCAGCCTGGACAGACAGCTACTCCACGTGCAATG
gtaagagggcctgtgggtgttggtgtcactgctgtgctgtgtgggctctttgctttaatt
cctctcacaacctaatgtttgaaaaatataggctttacagcagaagatgtgggacaagaa
ggaatggagaaaactcagttttggagttccctaccagcccccagcgttccagacaaaagc
EXON 3  246 bp
ggtaggtagcaggctagggaggacatgaaaatgcacttctgctccatcacccatgctggc
acatacacggactgtggttgtgtctctgagatatctggcagccaacagtacatccctgtg
tcagatactatggccaggaacagccaggggtcactcatgaggctgcttcctgttttgcag
TTTCCAGTGGGTTTTTTGGAGGCCAGTGGCATGAAATTCATCCTCAGTACTGGACCAAGT
ACCAGGTGTGGGAGTGGCTCCAGCACCTCCTGGACACCAACCAGCTGGATGCCAATTGTA
TCCCTTTCCAAGAGTTCGACATCAACGGCGAGCACCTCTGCAGCATGAGTTTGCAGGAGT
TCACCCGGGCGGCAGGGACGGCGGGGCAGCTCCTCTACAGCAACTTGCAGCATCTGAAGT
GGAACG
gtgactctctctttctgtgtctctccctaccctgctaggagccagctggaagaatagaga
ttctgcagatgacaggattctttgtcagggacaagaaagagtggtctcacctccaaatta
ccatgtcccaagacagagaaatggaaggaagatgaaaggacaggattgaagcatagggta
EXON 4  63 bp
agagactgcaggcttgagtttgtagaggctgacagagaaaccacctcccataaacaaaca
taggtgaccaggcagtaggatggcagaagctctgcaaagatgccagttctgtccttattt
aagcatccagttctggctccatctgggccctctctgactatcccaatctgtccttcacag
GCCAGTGCAGTAGTGACCTGTTCCAGTCCACACACAATGTCATTGTCAAGACTGAACAAA
CTG
gtgagtagtagtggacaaagggagccaacctagcctggcaaagctccggggaggacagtt
gggagagggcaagagagaatgtgggggcaagtttttgcaggaaacacagggaggcctttt
ccctggctgtctctgatgggccacccccaccatgaatctcattcttgcccttgcgaccag
EXON 5  69 bp
aaaggaaaattagacaacattattataaagtaacgcagctgaagcagaatcatatccctt
gtctctgaggaccactcctcaccccccatactttgttgatgaacaatgaattagaaaacg
cagcctcttctccctggggaaaagagatcgctgactattctccttctctattttttgtag
AGCCTTCCATCATGAACACCTGGAAAGACGAGAACTATTTATATGACACCAACTATGGTA
GCACAGTAG
gtaactaactccctgacacttaaggccctttacattcttattcagtttgtctaagagcca
cagtgttctattgtgaggtggggggagggggtgctctaaatgtcctttatcttttcatgg
ccacagatttgttggacagcaaaactttctgccgggctcagatctccatgacaaccacca
EXON 6  63 bp
tgcatcatttttctccatagcatttatcatctctgttttgtttggttcactagcacatac
tcaaaggtgccaggcatgcagtaggtgctcagtaaatattgtttaaatgagtggatgcat
gaataaaaaagagaattataggaaataggtcaattaaacgcctctcatttttctccttag
CAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCACACCAAAAAGC
ACA
gtaagttggctggctttcagatggcctttggtccttcccatcacatcgggcacatctgga
ggccactagttttttggcaaatatcgcctctgtctgctgccttcatgtcttcatcccaaa
cagggtggagtgagaaaatagaggcatcacttgctagcaaagtaagccccctctgcagct
EXON 7  196 bp
tttattcttaaatacctttttaatgtccaacatctggtgattctgcgatccatcttccct
gacaagtaggggagaaatgagtatctcctacttgcaggaagatgacctaactcaatgctc
tctgccctatctttgctgtgacttagatcattagtaacctgcctttctgcttttcatcag
ACCCGAGAGGGACTCACTTATGGGAATTCATCCGCGACATCCTCTTGAACCCAGACAAGA
ACCCAGGATTAATAAAATGGGAAGACCGATCTGAGGGCGTCTTCAGGTTCTTGAAATCAG
AGGCAGTGGCTCAGCTATGGGGTAAAAAGAAGAACAACAGCAGCATGACCTATGAAAAGC
TCAGCCGAGCTATGAG
gtgaggagtttcatgtctctgaaaacaaaaaggctgtacgacccattatttacctagcaa
ccttcatcggatcagtcaccttatgcaatctcctttgttacagatattactacaaaagag
aaattctggagcgtgtggatggacgaagactggtatataaatttgggaagaatgcccgag
EXON 8  1961 bp
gaggcagtggctcagctatggggtaaaaagaagaacaacagcagcatgacctatgaaaag
ctcagccgagctatgaggtgaggagtttcatgtctctgaaaacaaaaaggctgtacgacc
cattatttacctagcaaccttcatcggatcagtcaccttatgcaatctcctttgttacag
ATATTACTACAAAAGAGAAATTCTGGAGCGTGTGGATGGACGAAGACTGGTATATAAATT
TGGGAAGAATGCCCGAGGATGGAGAGAAAATGAAAACTGAAGCTGCCAATACTTTGGACA
CAAACCAAAACACACACCAAATAATCAGAAACAAAGAACTCCTGGACGTAAATATTTCAA
AGACTACTTTTCTCTGATATTTATGTACCATGAGGGGAACAAGAAACTACTTCTAACGGG
AAGAAGAAACACTACGGTCGATTAAAAAAATTATTTTGTTACTTCGAAGTATGTCCTATA
TGGGGAAAAAACGTACACAGTTTTCTGTGAAATATGATGCTGTATGTGGTTGTGATTTTT
TTTCACCTCTATTGTGAATTCTTTTTCACTGCAAGAGTAACAGGATTTGTAGCCTTGTGC
TTCTTGCTAAGAGAAAGAAAAACAAAATCAGAGGGCATTAAATGTTTTGTATGTGACATG
ATTTAGAAAAAGGTGATGCATCCTCCTCACATAAGCATCCATATGGCTTCGTCAAGGGAG
GTGAACATTGTTGCTGAGTTAAATTCCAGGGTCTCAGATGGTTAGGACAAAGTGGATGGA
TGCCGGGAAGTTTAACCTGAGCCTTAGGATCCAATGAGTGGAGAATGGGGACTTCCAAAA
CCCAAGGTTGGCTATAATCTCTGCATAACCACATGACTTGGAATGCTTAAATCAGCAAGA
AGAATAATGGTGGGGTCTTTATACTCATTCAGGAATGGTTTATCTGATGCCAGGGCTGTC
TTCCTTTCTCCCCTTTGGATGGTTGGTGAAATACTTTAATTGCCCTGTCTGCTCACTTCT
AGCTATTTAAGAGAGAACCCAGCTTGGTTCTTTTTTGCTCCAAGTGCTTAAAAATAAGTT
GGAAAAAGGAGACGGTGGTGTGGAAATGGCTGAAGAGTTTGCTCTTGTATCCCTATAGTC
CAAGGTTTCTCAATCTGCACAATTGACATTTTTGGCCGGAGTGTTCTTTGTGGTGAGGGC
TTTCCTGTGCATTGTAAGATGTTCAGCAGTATCCACTCATGGTCTCTAACCACTTGACAC
CAGAAACCCCCCAGCTGTGATAACGCAAAATGTCTCTAGACATCACCAAATGTTCCCTGG
GGGTGGCAAATTTGCCCTTGATTGAGAACCACCAGTTTAGCTAGTCAATATGAGGATGGT
GGTTTATTCTCAGAAGAAAAAGATATGTAAGGTCTTTTAGCTCCTTAGAGTGAAGCAAAA
GCAAGACTTCAACCTCAACCTATCTTTATGTTTTAAATGTTAGGGACAATAAGTTGAAAT
AGCTAGAGGAGCTTCTTTTCAGAACCCCAGATGAGAGCCAATGTCAGATAAAGTAAGCAT
AGTAATGTAGCAGGAACTACAATAGAAGACATTTTCACTGGAATTACAAAGCAGAATTAA
AATTATATTGTAGAAGGAAACACCAAGAAAAGAATTTCCAGGGAAAATCCTCTTTGCAGG
TATTAATTCTTATAATTTTTTGTCTTTTGGATTATCTGTTTACTGTCTCATCTGAACTGA
TCCCAGGTGAACGGTTTATTGCCTAGATTTGTACTCAGAGGAATTTTTTTTGTTTTGTTT
TGTCTTTTAAGAAAGGAAAGAAAGGATGAAAAAAATAAACAGAAAACTCAGCTCAGGCAC
AATTGTCACCAAGGAGTTAAAAGCTTCTTCTTCAATAGAGGAATTGTTCTGGGGGTCCTG
GAGACTTACCATTGAGCCATGCAATCTGGGAAGCACAGGAATAAGTAGACACTTTGAAAA
TGGATTTGAATGTTCTCATCCCTTTTGCAGCTTTTCTTTTTGGCTCTCTCATGTCCTTGG
CTTGCTCCTCTATTCTACCTCTCTTTCTCCAGCAATAATATGCAAATGAAGACATGTATC
CATAAGAAGGAGTGCTCTTCATCAACTAATAGAGCACCTAC
cacagtgtcatacctggtagaggtgagcaattcatattcaaaggttgcaaagtgtttgta
atatattcatgaggctggaagtaagaagaattaaaaatttgtcctaattacaatgagaac
cattctaggtagtgatcttggagcacacatgaataactttctgaaggtgcaaccaaatcc