Gene EHF Variant 1
DNA : 39.72 KbNT_009237
mRNA : 2922 bp NM_012153
CDS : 903 bp NP_036285
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  155 bp
acctgttttgtttgaacactaacgtgtgagttggccaaatgcaaatgagccagtgtttgt
aatcctttattttatttttttaaagggctgggtagccaatcagaagagggggaagtgact
tagggaattcccggttggtggcttattgcttaacatcctacaaaatgatttaaaattatt
GTTATATGCATTTATCTTCACTCTGATGAGGGCTCAGACTTGATAACACCCGTGGTGCCC
CATCCCTATAGGAGCTGGTGAGATTGCAGCCTGCTGCCTCCCCTCCAACAGCCACAGCTA
TTGGATTTCCCACCCAGAATCTTTAGGTAAATGAG
gtaagtcctgatttttaaaacttcttttgaatctggaatccaaacacttgagtggaaaga
gaagcctgctttaaactggacagatgaaactagaacagactcttggagacggctggcagg
aagtgaagctcaccttacctgggcttacctcactgggtcaaatcagaattttattttgga
EXON 2  100 bp
gaaatttttaattgctgtgagttttgcttttacaaaaaacgctttggcaatgggtggcag
gcaatgggtggaaggacaaattctctttattttcttcctaaatttactctgtgatctgca
ctttccaatgacatttgtccaagaggcactgactgaacaggctgtttgatcccctaacag
ATCATGATTCTGGAAGGAGGTGGTGTAATGAATCTCAACCCCGGCAACAACCTCCTTCAC
CAGCCGCCAGCCTGGACAGACAGCTACTCCACGTGCAATG
gtaagagggcctgtgggtgttggtgtcactgctgtgctgtgtgggctctttgctttaatt
cctctcacaacctaatgtttgaaaaatataggctttacagcagaagatgtgggacaagaa
ggaatggagaaaactcagttttggagttccctaccagcccccagcgttccagacaaaagc
EXON 3  246 bp
ggtaggtagcaggctagggaggacatgaaaatgcacttctgctccatcacccatgctggc
acatacacggactgtggttgtgtctctgagatatctggcagccaacagtacatccctgtg
tcagatactatggccaggaacagccaggggtcactcatgaggctgcttcctgttttgcag
TTTCCAGTGGGTTTTTTGGAGGCCAGTGGCATGAAATTCATCCTCAGTACTGGACCAAGT
ACCAGGTGTGGGAGTGGCTCCAGCACCTCCTGGACACCAACCAGCTGGATGCCAATTGTA
TCCCTTTCCAAGAGTTCGACATCAACGGCGAGCACCTCTGCAGCATGAGTTTGCAGGAGT
TCACCCGGGCGGCAGGGACGGCGGGGCAGCTCCTCTACAGCAACTTGCAGCATCTGAAGT
GGAACG
gtgactctctctttctgtgtctctccctaccctgctaggagccagctggaagaatagaga
ttctgcagatgacaggattctttgtcagggacaagaaagagtggtctcacctccaaatta
ccatgtcccaagacagagaaatggaaggaagatgaaaggacaggattgaagcatagggta
EXON 4  63 bp
agagactgcaggcttgagtttgtagaggctgacagagaaaccacctcccataaacaaaca
taggtgaccaggcagtaggatggcagaagctctgcaaagatgccagttctgtccttattt
aagcatccagttctggctccatctgggccctctctgactatcccaatctgtccttcacag
GCCAGTGCAGTAGTGACCTGTTCCAGTCCACACACAATGTCATTGTCAAGACTGAACAAA
CTG
gtgagtagtagtggacaaagggagccaacctagcctggcaaagctccggggaggacagtt
gggagagggcaagagagaatgtgggggcaagtttttgcaggaaacacagggaggcctttt
ccctggctgtctctgatgggccacccccaccatgaatctcattcttgcccttgcgaccag
EXON 5  69 bp
aaaggaaaattagacaacattattataaagtaacgcagctgaagcagaatcatatccctt
gtctctgaggaccactcctcaccccccatactttgttgatgaacaatgaattagaaaacg
cagcctcttctccctggggaaaagagatcgctgactattctccttctctattttttgtag
AGCCTTCCATCATGAACACCTGGAAAGACGAGAACTATTTATATGACACCAACTATGGTA
GCACAGTAG
gtaactaactccctgacacttaaggccctttacattcttattcagtttgtctaagagcca
cagtgttctattgtgaggtggggggagggggtgctctaaatgtcctttatcttttcatgg
ccacagatttgttggacagcaaaactttctgccgggctcagatctccatgacaaccacca
EXON 6  69 bp
acacctggaaagacgagaactatttatatgacaccaactatggtagcacagtaggtaact
aactccctgacacttaaggccctttacattcttattcagtttgtctaagagccacagtgt
tctattgtgaggtggggggagggggtgctctaaatgtcctttatcttttcatggccacag
ATTTGTTGGACAGCAAAACTTTCTGCCGGGCTCAGATCTCCATGACAACCACCAGTCACC
TTCCTGTTG
gtaagctgtcatcacatctgaggctgggtatgcctaatgcttagggagaatcagtgggaa
ttaccaacactctacatttctgcctttctggagtctttctaattaaagggctaggaaagg
gatggggttaccattagacgaggtttgcttttgaggcaatatttgtacatcgaagatgac
EXON 7  63 bp
tgcatcatttttctccatagcatttatcatctctgttttgtttggttcactagcacatac
tcaaaggtgccaggcatgcagtaggtgctcagtaaatattgtttaaatgagtggatgcat
gaataaaaaagagaattataggaaataggtcaattaaacgcctctcatttttctccttag
CAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCACACCAAAAAGC
ACA
gtaagttggctggctttcagatggcctttggtccttcccatcacatcgggcacatctgga
ggccactagttttttggcaaatatcgcctctgtctgctgccttcatgtcttcatcccaaa
cagggtggagtgagaaaatagaggcatcacttgctagcaaagtaagccccctctgcagct
EXON 8  196 bp
tttattcttaaatacctttttaatgtccaacatctggtgattctgcgatccatcttccct
gacaagtaggggagaaatgagtatctcctacttgcaggaagatgacctaactcaatgctc
tctgccctatctttgctgtgacttagatcattagtaacctgcctttctgcttttcatcag
ACCCGAGAGGGACTCACTTATGGGAATTCATCCGCGACATCCTCTTGAACCCAGACAAGA
ACCCAGGATTAATAAAATGGGAAGACCGATCTGAGGGCGTCTTCAGGTTCTTGAAATCAG
AGGCAGTGGCTCAGCTATGGGGTAAAAAGAAGAACAACAGCAGCATGACCTATGAAAAGC
TCAGCCGAGCTATGAG
gtgaggagtttcatgtctctgaaaacaaaaaggctgtacgacccattatttacctagcaa
ccttcatcggatcagtcaccttatgcaatctcctttgttacagatattactacaaaagag
aaattctggagcgtgtggatggacgaagactggtatataaatttgggaagaatgcccgag
EXON 9  1961 bp
gaggcagtggctcagctatggggtaaaaagaagaacaacagcagcatgacctatgaaaag
ctcagccgagctatgaggtgaggagtttcatgtctctgaaaacaaaaaggctgtacgacc
cattatttacctagcaaccttcatcggatcagtcaccttatgcaatctcctttgttacag
ATATTACTACAAAAGAGAAATTCTGGAGCGTGTGGATGGACGAAGACTGGTATATAAATT
TGGGAAGAATGCCCGAGGATGGAGAGAAAATGAAAACTGAAGCTGCCAATACTTTGGACA
CAAACCAAAACACACACCAAATAATCAGAAACAAAGAACTCCTGGACGTAAATATTTCAA
AGACTACTTTTCTCTGATATTTATGTACCATGAGGGGAACAAGAAACTACTTCTAACGGG
AAGAAGAAACACTACGGTCGATTAAAAAAATTATTTTGTTACTTCGAAGTATGTCCTATA
TGGGGAAAAAACGTACACAGTTTTCTGTGAAATATGATGCTGTATGTGGTTGTGATTTTT
TTTCACCTCTATTGTGAATTCTTTTTCACTGCAAGAGTAACAGGATTTGTAGCCTTGTGC
TTCTTGCTAAGAGAAAGAAAAACAAAATCAGAGGGCATTAAATGTTTTGTATGTGACATG
ATTTAGAAAAAGGTGATGCATCCTCCTCACATAAGCATCCATATGGCTTCGTCAAGGGAG
GTGAACATTGTTGCTGAGTTAAATTCCAGGGTCTCAGATGGTTAGGACAAAGTGGATGGA
TGCCGGGAAGTTTAACCTGAGCCTTAGGATCCAATGAGTGGAGAATGGGGACTTCCAAAA
CCCAAGGTTGGCTATAATCTCTGCATAACCACATGACTTGGAATGCTTAAATCAGCAAGA
AGAATAATGGTGGGGTCTTTATACTCATTCAGGAATGGTTTATCTGATGCCAGGGCTGTC
TTCCTTTCTCCCCTTTGGATGGTTGGTGAAATACTTTAATTGCCCTGTCTGCTCACTTCT
AGCTATTTAAGAGAGAACCCAGCTTGGTTCTTTTTTGCTCCAAGTGCTTAAAAATAAGTT
GGAAAAAGGAGACGGTGGTGTGGAAATGGCTGAAGAGTTTGCTCTTGTATCCCTATAGTC
CAAGGTTTCTCAATCTGCACAATTGACATTTTTGGCCGGAGTGTTCTTTGTGGTGAGGGC
TTTCCTGTGCATTGTAAGATGTTCAGCAGTATCCACTCATGGTCTCTAACCACTTGACAC
CAGAAACCCCCCAGCTGTGATAACGCAAAATGTCTCTAGACATCACCAAATGTTCCCTGG
GGGTGGCAAATTTGCCCTTGATTGAGAACCACCAGTTTAGCTAGTCAATATGAGGATGGT
GGTTTATTCTCAGAAGAAAAAGATATGTAAGGTCTTTTAGCTCCTTAGAGTGAAGCAAAA
GCAAGACTTCAACCTCAACCTATCTTTATGTTTTAAATGTTAGGGACAATAAGTTGAAAT
AGCTAGAGGAGCTTCTTTTCAGAACCCCAGATGAGAGCCAATGTCAGATAAAGTAAGCAT
AGTAATGTAGCAGGAACTACAATAGAAGACATTTTCACTGGAATTACAAAGCAGAATTAA
AATTATATTGTAGAAGGAAACACCAAGAAAAGAATTTCCAGGGAAAATCCTCTTTGCAGG
TATTAATTCTTATAATTTTTTGTCTTTTGGATTATCTGTTTACTGTCTCATCTGAACTGA
TCCCAGGTGAACGGTTTATTGCCTAGATTTGTACTCAGAGGAATTTTTTTTGTTTTGTTT
TGTCTTTTAAGAAAGGAAAGAAAGGATGAAAAAAATAAACAGAAAACTCAGCTCAGGCAC
AATTGTCACCAAGGAGTTAAAAGCTTCTTCTTCAATAGAGGAATTGTTCTGGGGGTCCTG
GAGACTTACCATTGAGCCATGCAATCTGGGAAGCACAGGAATAAGTAGACACTTTGAAAA
TGGATTTGAATGTTCTCATCCCTTTTGCAGCTTTTCTTTTTGGCTCTCTCATGTCCTTGG
CTTGCTCCTCTATTCTACCTCTCTTTCTCCAGCAATAATATGCAAATGAAGACATGTATC
CATAAGAAGGAGTGCTCTTCATCAACTAATAGAGCACCTAC
cacagtgtcatacctggtagaggtgagcaattcatattcaaaggttgcaaagtgtttgta
atatattcatgaggctggaagtaagaagaattaaaaatttgtcctaattacaatgagaac
cattctaggtagtgatcttggagcacacatgaataactttctgaaggtgcaaccaaatcc