Gene DPAGT1 Variant 1
DNA : 5.13 KbNT_033899
mRNA : 1701 bp NM_001382
CDS : 1203 bp NP_001373
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  148 bp
gtgtcccgacggcggctcaagtcagagttgctgggttttgctcagattggtgtgggaaga
gcctgcctgtggggagcggccactccatactgctgaggcctcaggactgctgctcagctt
gcccgttacctgaagaggcggcggagccgggcccctgaccggtcaccatgtgggccttct
CGGAATTGCCCATGCCGCTGCTGATCAATTTGATCGTCTCGCTGCTGGGATTTGTGGCCA
CAGTCACCCTCATCCCGGCCTTCCGGGGCCACTTCATTGCTGCGCGCCTCTGTGGTCAGG
ACCTCAACAAAACCAGCCGACAGCAGAT
gtgagcagcggcacacgggtccgggcagggggcaagggctaaggaaggagtggctagggc
aggggcgggaaccggggtgcttgaccacacgtgaagactcagaactaacccaggcagcct
ggaactcggagaggtgatgagcagaacttactcgcattggggaaaggatgggtagggacc
EXON 2  121 bp
gacccttgggtatatctgggactctggcagtggtgctttcctccctccgcccccctcacc
acttaccagaataaaaaaccgggaatgagaagaccactttgggttactgtaacacctgca
ctagtgagtgaccacgccccctttcctcttccccctcgcccccttgctgctgggccacag
CCCAGAATCCCAGGGAGTGATCAGCGGTGCTGTTTTCCTTATCATCCTCTTCTGCTTCAT
CCCTTTCCCCTTCCTGAACTGCTTTGTGAAGGAGCAGTGTAAGGCATTCCCCCACCATGA
A
gtaagtgggttcgtgggggtgattgcctgtggctgggacctgggaggtacctgagagaac
tggggttatttgggcttgtggggaggggctaagaaattatcagaaaagacaggaattctt
aaaaggtggaatgggagcaggcttgagtcatggacctgcccgagcctcccccagtttgtg
EXON 3  214 bp
catgaagtaagtgggttcgtgggggtgattgcctgtggctgggacctgggaggtacctga
gagaactggggttatttgggcttgtggggaggggctaagaaattatcagaaaagacagga
attcttaaaaggtggaatgggagcaggcttgagtcatggacctgcccgagcctcccccag
TTTGTGGCCCTGATAGGTGCCCTCCTTGCCATCTGCTGCATGATCTTCCTGGGCTTTGCG
GATGATGTACTGAATCTGCGCTGGCGCCATAAGCTGCTGCTACCTACAGCTGCCTCACTA
CCTCTCCTCATGGTCTATTTCACCAACTTTGGCAACACGACCATTGTGGTGCCCAAGCCC
TTCCGCCCGATACTTGGCCTGCATCTGGACTTGG
gtaggtagtcctaccactgctgcccctatggcacctacttcagggaacccttcctggtgc
tccacattctcctccaagtgttccttttttgtctctgtgtcttcccagatcctttctggt
agcccttcatcctatcgtccgtcctcaccacttttctaaaaattcttaaatcctcctccc
EXON 4  147 bp
agggaacccttcctggtgctccacattctcctccaagtgttccttttttgtctctgtgtc
ttcccagatcctttctggtagcccttcatcctatcgtccgtcctcaccacttttctaaaa
attcttaaatcctcctcccctaggtggcactacttcttttcctaccatctctccccgcag
GAATCCTGTACTATGTCTACATGGGGCTGCTGGCAGTGTTCTGTACCAATGCCATCAATA
TCCTAGCAGGAATTAACGGCCTAGAGGCTGGCCAGTCACTAGTCATTTCTGCTTCCATCA
TTGTCTTCAACCTGGTAGAGTTGGAAG
gtaggtgggattgggggtggggagagagaagtctgagtgttaaaggtgtggcctgatata
tgactttgggaaattcaggggaaaaaagcaatatgcatagtaattatagaagataaggga
agctacttactttgcaaataacaatgcagatttattaaaagtgagaaagaaaaatagtag
EXON 5  85 bp
acgaaagaggtggaatattgggaattgccttgggtgacataaaaggagtattgagttctt
aaaagtgacttgggtgaggtggatgataacagctgtaaacagaacttagacaaaaatagg
accaaggtttgcagaggaagtgggtattaacttttccttctttcttccttgcttccaaag
GTGATTGTCGGGATGATCATGTCTTTTCCCTCTACTTCATGATACCCTTTTTTTTCACCA
CTTTGGGATTGCTCTACCACAACTG
gtaagtaggcctgtggataaggggacaactacctgaacacatggcaaagatggcccttat
cataacccaccttgtggtggtgaagctaaacctgcgcatacctctatggagttttctgcg
tcttcagttggtcgtattctgaaatttctctctacccagtagtagttagggatgagtgcg
EXON 6  189 bp
gtggaggccccaggaatagatgaattcagggccttggatcctgcagagttgctgcacaac
tggagtctcctctgagtcagaactagggtcagggctagtccagtgcccatagggtgtgat
gtgagagaagggattggtaatgcctcttgccactggctcggatcctcttcccccacacag
GTACCCATCACGGGTGTTTGTGGGAGATACCTTCTGTTACTTTGCTGGCATGACCTTTGC
CGTGGTGGGCATCTTGGGACACTTCAGCAAGACCATGCTACTATTCTTCATGCCCCAGGT
GTTCAACTTCCTCTACTCACTGCCTCAGCTCCTGCATATCATCCCCTGCCCTCGCCACCG
CATACCCAG
gtagccgctttttggcttgaaatggacatcatagccttttcacttgggatatctaatgcc
agcctatacatttgctgtgcaaagggagtgggcccaaagaagggctatttccatgtgagt
agccctttataacttacaaagcacatttatttgcataatctgctacagtggttctgataa
EXON 7  88 bp
cctttataacttacaaagcacatttatttgcataatctgctacagtggttctgataacag
taagcagcagagccagaaatagatctcaggttgactccacattcaatgctcttcctatta
gccacagggaggagggttcaaatagtggcccagtcacatgaagctatcttccccccgcag
ACTCAATATCAAGACAGGCAAACTGGAGATGAGCTATTCCAAGTTCAAGACCAAGAGCCT
CTCTTTCTTGGGCACCTTTATTTTAAAG
gtaacagggtaacaaggaggtaaggccctaggctgccatcctgaccttgaggaatgggga
acctagtcctacatcagatccaaggggaacttgaaagcattaaatagatccacattccta
aagcataggtattagctgaggttctcttcacctctggtccctccaggtggcagagagcct
EXON 8  156 bp
cctttattttaaaggtaacagggtaacaaggaggtaaggccctaggctgccatcctgacc
ttgaggaatggggaacctagtcctacatcagatccaaggggaacttgaaagcattaaata
gatccacattcctaaagcataggtattagctgaggttctcttcacctctggtccctccag
GTGGCAGAGAGCCTCCAGCTGGTGACAGTACACCAGAGTGAGACTGAAGATGGTGAATTC
ACTGAATGTAACAACATGACCCTCATCAACTTGCTACTTAAAGTCCTTGGGCCCATACAT
GAGAGAAACCTCACATTGCTCCTGCTGCTGCTGCAG
gtgaggatgggaatcgagtttatacctccgtgtctccctttctgcgtgattcttactcca
gtccatttctccttgcagatcctgggcagtgccatcaccttctccattcgatatcagctc
gttcgactcttctatgatgtctgagtcccttgatcattgtcctttacctcacagtctcta
EXON 9  553 bp
gaattcactgaatgtaacaacatgaccctcatcaacttgctacttaaagtccttgggccc
atacatgagagaaacctcacattgctcctgctgctgctgcaggtgaggatgggaatcgag
tttatacctccgtgtctccctttctgcgtgattcttactccagtccatttctccttgcag
ATCCTGGGCAGTGCCATCACCTTCTCCATTCGATATCAGCTCGTTCGACTCTTCTATGAT
GTCTGAGTCCCTTGATCATTGTCCTTTACCTCACAGTCTCTAGGATTCCTGACTCAGGCT
GACCTCTCTCTCTGGTCCCAGACTGCCTCCTTGCCCAGGCCTCTCTCACTCTTCATACTC
CTCCAGATTTTGTTCTCAGCATTTTCCTTTCTCTGTGATCATTGGCATCCTGGGCGTTTC
TTGCCCTCTGCTGACTACTGATTGGATTTTACCTATGGCTTTCTGCAACTTGCTACTCTC
TCCCTCTCCATCCCATCTTTGCAGCCTCATAGGGTGGGATACAGCAGCTTTTTTTGCAGT
TATCCACACTCACATTTCAGAGTCCTGACTCTCAAGGAACCACTGGTTTTTGGGATAGAA
CTTGGGCCAGGGCTAGGAACACAGGCTCCACGGTGACATGTCATTTGATTGTAAATTAAG
TGTTCTGATTAGTAAGAACTAAGCAGGGGGCCACATGCTCTCAATGGAGACAATAAAGTG
TTGTCTTTTTCTT
attgtttatgtaggtatatttcctatatgggcatttttgggtagattgggaggggtggtg
ggggtacttcctccaacaggatgcctatctctctgccccatcagaccccgtctaacaaga
agtgaacagaactgagaccaaacagaacatattgaataaatatttaaatcctgatactag