Gene DDX10 Variant 1
DNA : 275.83 KbNT_033899
mRNA : 3189 bp NM_004398
CDS : 2628 bp NP_004389
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  251 bp
gcccccttccgtggagtgctgcgcccccgtttccccaggctgcccctcccagcaggagcc
aattcgccaatcacagccctccttttcctgacgtcattggcgcgtgccccggtttcaaaa
gctcgggggcgggcttctgagttcgcgcatgcgcctctgtgcgtttgtcccatgctggtt
CCGTGAGTCTGGCCTTAGGTGTCTCGTGTCTGGGGTTGATCCGAGCTGTCGCCGCCGCCG
CCGCAATGGGCAAAACGGCCAACTCTCCGGGTTCGGGAGCCCGACCCGACCCGGTGCGGA
GCTTCAATCGCTGGAAGAAAAAACACAGCCATAGGCAGAACAAAAAGAAGCAGTTGAGGA
AGCAACTGAAGAAACCCGAATGGCAGGTCGAGCGCGAGAGTATCAGCCGCCTCATGCAGA
ACTATGAAAAG
gtgaggccggcgctggggagggggctcgggccggccagcagcggggcagcgtctcactgc
ggcgaggagttgcagagtggaggcggcggatctgtcaccgggacccggccgggaatgaga
ggtcacgccgggtgccacagctcaaacctctgcaccgttctggccactcttctgcttgcc
EXON 2  61 bp
ttcagggacagcctcttcagggcatatttcgttacagaaggaatgatggcttttaattag
aagcgatgattgaattcaaccctgaattaccaaggatgagctgggcaatacaatgtagag
aagaaatggctgtgtcgtgaaacaaatgagttaccctgattcctttttctttttttccag
ATAAATGTAAATGAAATCACAAGATTTTCAGATTTTCCCTTGTCCAAAAAAACATTGAAA
G
gtaagtatatggtgatcttgggatgtgttattggatttcttggcatttttgataaatggg
agaagatttagagggtttagcctgaaaaatcttattttggcaaattttgatatcatgaaa
accaatgaaaataagcaatattcaagttttaacagtacgttattctcattctttctggac
EXON 3  131 bp
ccctatggggctctaacttaatcaacctctttaaaggccctgtctccaagtatagttatg
ttctgaggtacgaggcattagggcttcaacataggaattttgggggacacaactcactta
gcctataataccatcctacagggatcttctaaagtataattcttccctccatgttgccag
GTTTGCAAGAAGCTCAGTACCGTTTGGTGACTGAGATACAGAAGCAGACCATTGGATTGG
CTTTGCAAGGTAAAGATGTACTTGGAGCGGCCAAAACTGGATCTGGCAAGACTCTGGCTT
TTCTTGTTCCA
gtaagtacattgtcattgggtcagactgtctgttatacaattttataacattctgtgccc
agatgcagattatataaagagatgttttcatgttagatttcatgatagattggctagaat
gcgagcttcatcaaacaggagccacatgtgtgtcttgttctcaccattttccccaggttc
EXON 4  159 bp
gttgggggtggatggttctgatggaagataaacaaaatcatttactttggactggataaa
acttgagtggtatgccttctgcttggaagatccctttgatttggaggggcaaggttgaga
tgcaggtcaaaaagctgacttctgatgacttactgaacatgaatttgctgtctttttgag
GTGCTGGAAGCCTTATATCGTCTGCAATGGACTTCAACAGATGGGCTGGGGGTTCTCATA
ATATCACCTACGAGAGAACTGGCCTATCAGACCTTTGAGGTTCTCCGAAAAGTAGGAAAG
AATCATGACTTCTCAGCTGGTCTCATCATTGGTGGAAAG
gtttgtccttttgtctatgtccttcctttccttctgtaacctatactggagtactgtggc
cgatgacagggaggcagcagagacttcatctaaacagactgacctagaccagggcctcat
gggatagtagcacttggtgtggtcgctgctatctacgatctggttgccaattttgcaggc
EXON 5  121 bp
acttttatttagcccagaaatgtggatatggttcagaaatacaagggaaaagttatgttt
atttccaagagtatctaaaatgttgtgatgaaatgcccatgcagatggcttttatagctt
tggtacacaggctgctgagagtgatgtgtctgtgtaatcaaaataaataactgttttcag
GATCTAAAACACGAAGCTGAGAGGATCAACAACATAAATATACTCGTGTGCACACCAGGT
CGGCTTCTTCAACACATGGATGAAACAGTATCTTTTCATGCTACCGACCTCCAAATGTTA
G
gtgagtcaaatcaatttctaatttaaaaaaaaaaaaagctcagacttaggagagagccct
tatacatttttatgatagaaattttatgttagataaatgttatgattcaaaacaaactta
aaaattactgaaacattttggcatttgggctctaaacccagaaagtaaaagtagacttaa
EXON 6  190 bp
cttttatcaaaactaaggttaacattgctacatcatataaattccagactttattcaggt
tttaccagtttttccgctaatgttctttttctgttttaggatccaatccaggatacccat
tgcatttagcctaatgtatattttacatatgatagttcaacttgcattttcctttttcag
TTCTTGATGAAGCAGATAGAATCTTGGATATGGGCTTTGCTGATACCATGAATGCTGTTA
TTGAAAATCTCCCCAAGAAACGTCAGACTTTACTTTTCTCAGCAACACAAACTAAATCTG
TAAAGGACCTTGCACGCTTGAGTTTGAAAAACCCTGAGTATGTCTGGGTTCATGAAAAAG
CAAAATATAG
gtatgtactctttgagtcaatcaagataaatgttttttacttttttagtttagggatttg
gtattttaaatatctgttttctgggaattaagacattctatgagttattggttatgcaaa
gcatagtaaatataccagttaaaattacccaaattctgcatatatctttaaatgtcaggg
EXON 7  127 bp
aagtaatgtgttgaatttgtttcctaagggacaatagagaaaaattctttttttggtgta
tgtgtgtaggaaatttgcttgagagatgtgccactattaaaacttgtttccttttttggt
ctggatttcagttacttacatgacatattctaatgtttttcttttccgtaattccacaag
CACCCCTGCCACTTTGGAACAGAACTACATAGTCTGTGAGCTGCAGCAAAAAATAAGTGT
GCTGTATTCCTTTTTGAGAAGCCATCTGAAGAAGAAGAGCATTGTATTTTTTTCCAGTTG
CAAAGAG
gtattggctgtttattttgctttctgaacgtatgttgaatgtcccttttgaaatggcaaa
tcaattagacaaattattatattgtacgagaagtacagtgctaggtgtggtgagggatct
ttcgtgtccttgttgcaaaggaatccgtggctgagactttcaactccacaaggacagaaa
EXON 8  163 bp
aaggagggaaggaaattaaattgcttgtgattaaataagagtttctttactttttttact
tggttggaattgggtatcacattgctctgctgttgagactctgtgggatacgttgataag
agaaaagctttattgctgccatctgccataagcaaacttattcttctgttgatgccccag
GTCCAGTATCTGTACCGAGTGTTTTGCCGGCTACGTCCTGGTGTTTCTATCCTTGCACTC
CATGGTCGACAGCAGCAAATGAGAAGAATGGAAGTCTATAATGAGTTTGTCCGTAAGAGA
GCTGCAGTACTCTTTGCTACTGATATTGCAGCCAGGGGTCTGG
gtaagaaaacttcctatcatgaaatttctgtgattgtgtgaaatgtaatttgcttataaa
gtatattttgggaaatctgatagactcaaacacttgggtttcttttcttattttgtaaga
gaaaagtaagtagtaaattggtagcagttgactaacattaaggatgtatcagtgaaaatt
EXON 9  85 bp
aagagaaatgtttactatctcttggttcatgcaattaattttatttttaatagagttcat
agatgatatccatcagtttgatgtgatgaaaagtcctggcaagcaatattttaagataaa
aatagtgcagcagggcagatcttgcaaccagtttcttaacttcacatcccttctctgtag
ATTTCCCGGCCGTGAATTGGGTTCTTCAGTTTGATTGTCCTGAGGATGCCAACACATATA
TTCACAGAGCAGGTAGAACTGCCAG
gtaggtgtactgactaatttcttttcttttgctactatctaaataacaaagcatgctttt
ccaactgcagataaacgaagaaaggaatcaggtaagtgagtgctggtttggcattttgtg
gtgtgagttgacagctactgtaaatcattatggctaagacttgattagtgctgcaaaaaa
EXON 10  99 bp
gtgatgaaaatgatatgaggtgttcagagccctagttttctgttatcagagattaaaagc
cagtctctgacatttatggttagacaaaaatggtttccatgtttacctatgcatcactct
gttaaaatgtaaaatgcagattgcattgatgtgttaaagattttgtttctttttgtttag
GTACAAAGAGGATGGTGAAGCTTTGCTAATTTTGCTACCCTCAGAAAAAGCTATGGTGCA
GCAGCTTCTTCAGAAGAAAGTACCTGTGAAGGAAATCAA
gtaagagctacttgttgtctttatgtttttaggaaaatgagggcatgaaattgtttgctt
aattatgtgcacctaatttgccccttcccctaatttattcaactgcctggtttgactttt
ataaaaaggctctttttagaacagttttaggttcacaggaaaattgagaggaagatagat
EXON 11  88 bp
tattcatagtaggtaagagtgtcaaacttatgtctagtttaatttccgtctaatctgatt
catagatgagaaatagttatacatttaaaaatactgaggaaaataggaaaatgctgctta
ctatttttagtctccaaatttgagatatcttattttaacctttatctttttgttacaaag
AATCAATCCAGAAAAACTTATAGATGTCCAGAAAAAATTGGAATCTATTTTAGCTCAAGA
TCAAGATTTAAAAGAAAGAGCTCAAAGG
gtaagtcatttttcagttggatactttcattgactggaaaaacagtaaagtttatcattt
tctgctacttctaggttgcatgtttatgcttcagatattcaagcagtgtaatttgctgac
agataagtctagcttatttttttttttgagatggagtctcactctgtagccctagctgga
EXON 12  89 bp
ttctaatattacagttctaaaaggtaggttttcatgtgtgcatggaatggagatatactg
aactatttcgtggtttttcagtactattgaatttatcccattggctaattttcttatatt
ttggtctaaactcatttttaatttctattatattgtacttttcaacctcttaatttacag
TGTTTCGTCTCCTATGTACGATCTGTATATCTGATGAAGGATAAAGAAGTATTTGATGTG
AGCAAGTTACCTATACCTGAATATGCCCT
gtaagtattcataatatagttgtaatagtgaatcctcaaggttagagggaattaattaat
taatttagagatggggtcttgctatgttgcccaggctgtctcaaacccctgtgctccagc
agtccacccacctcaacttcctgaagtgttaggactacaggcgtaagccaccacacccgg
EXON 13  466 bp
ttgagtgtattttgccttactttttggatcaactaacctgttagtattgagttgtatctc
acaggaacattttctttaaaaaagctctaggaatctctgctcttgagaaactcttctatg
acacctataaacatatcatcagtgttgagatgactgttttcacgtttttccatatttaag
GTCTCTTGGTCTTGCTGTGGCACCACGCGTAAGATTTCTTCAGAAAATGCAGAAACAACC
CACCAAAGAATTGGTAAGGAGCCAAGCCGATAAAGTAATTGAGCCAAGGGCTCCCTCCCT
CACCAATGACGAAGTGGAAGAATTTAGAGCCTACTTCAATGAGAAAATGTCCATCCTTCA
AAAAGGTGGAAAAAGACTCGAAGGGACAGAGCACAGACAGGATAATGATACTGGTAATGA
AGAACAGGAAGAAGAAGAAGACGATGAAGAAGAAATGGAAGAGAAACTGGCAAAAGCAAA
AGGATCTCAAGCCCCATCTCTTCCTAACACCAGTGAGGCACAGAAGATCAAGGAAGTTCC
TACACAGTTCTTGGACAGAGATGAGGAGGAAGAAGATGCTGATTTCTTGAAGGTGAAGCG
GCATAATGTGTTTGGATTGGACCTTAAAGACGAGAAAACATTACAG
gtaagtttactcccagtggagggtcttctattacattgtcttactatgtgcttattgttg
ccttttggggactgagagaaagtgaaaactaagaaacttagactgggtttctttgcaatg
aactcttcctcctttcccccatacttaaacacagaataagtgccaatgaattttcatatt
EXON 14  120 bp
ggaggagttcttagttaataagtcaaataatgttattcctggacagtgttttcaatgctt
ctcattagccaatgagtaataaatgtacccagttttgagaagtatattgccagagttgga
ttgttaatataaagcaaccattttcctaatcatctgtgttttttgtatgttctcacacag
AAGAAAGAACCTTCTAAATCCAGCATCAAGAAAAAAATGACCAAAGTTGCAGAAGCAAAA
AAAGTAATGAAGAGAAATTTTAAAGTGAATAAGAAGATAACATTTACTGATGAAGGGGAG

gtaagattctagaagtgtttcatttctgaggtgcatttggagtattagaagagatcgact
ctctcttacttagcactcattaatgatagagtaaatgtttctctacagcatgctgggcca
ttcctttcactgttactgtaggctgtacatcagctctactgctgtgaacaaggatgcctt
EXON 15  162 bp
tactctgactagggcagtctcttctatggcttgaagttgattagaagattaaataataca
gattagattgtaaggcagaaaatgggtatctgcaccttttcagaatcatcagacaaaatg
aagtgtctttctggggtattccctacttcctgttgacactgaccttttttttacctgtag
TTGGTTCAGCAGTGGCCACAAATGCAGAAATCTGCCATCAAGGATGCTGAGGAAGATGAT
GACACAGGTGGTATCAACTTACATAAAGCAAAGGAAAGACTTCAGGAAGAGGACAAATTT
GACAAAGAAGAATATAGGAAAAAAATTAAGGCAAAGCATCGG
gtaagctttccatcttgaattcatactgagtaaaatttagtgtcccgaagtatatctaaa
tattcattagctattcattaataagtgtattattttcttcattgttttctctgacacttc
tttttctgtggctactcttttttctgtttatttgttcctttgctgggggagtctgtatat
EXON 16  57 bp
gacacattcttaatgattcatgaatacttgtgccaatcccatagtagtagtcagtaaata
tttgttgaaaaatgaatgtcatatattagttagctttaggaaataaaactgtaatgaatg
tgtagtctgttttatacctaattatatgctgctaatttttctcctcttccttgtctccag
GAGAAAAGACTGAAAGAAAGGGAAGCCAGAAGAGAAGCCAACAAGAGACAAGCAAAG
gtaagggtttatatacatttatttttccaagctctattaaggtagaatggacaaaagcat
tttatattttggcaagaacaatgcttataatgttaaaatggaatttaaatcctcttcttt
tcaacatggattttatatattatttgtatatcatgatattccaattggattcaagcccat
EXON 17  146 bp
aggattttcatttctttgccaatggttgtggttctgaaagtcacataagggcctacacca
gaagagaaagctaatctgtggatgtcaattagagggatatccattggggtctgcaaataa
aacctgattatttatcaactgacttcttcaactgcagtttcccttattattattttttag
GCCAAAGATGAAGAGGAAGCCTTTCTGGATTGGAGTGATGATGATGATGATGATGATGAT
GGATTTGATCCAAGCACACTCCCAGATCCAGATAAATACAGAAGCTCTGAAGATTCAGAT
AGTGAAGATATGGAAAATAAAATAAG
gtatgtttttactatgggtatgaaatacatacttagtactctcacatcagtcttttaatg
aatccaaaagacattactaagagttctactccaagagatgtttgttgcttttttttgata
cctttacttagattcctggaaatcctgctgctgtttttttactcattttgctgcagattg
EXON 18  674 bp
tggtaggacctagctactgatgggaaggtacttactaattatacagatatcttgatgttg
ccatggtttccttcattcttgaataatatcactttaccaactctctgttaattttgtcct
attttaaatgtttgatttcatactgagtctaaagtaaatctttggatttcttctcaccag
TGATACCAAGAAGAAGCAGGGGATGAAGAAGAGGAGCAACAGTGAAGTGGAAGACGTGGG
ACCAACAAGTCATAACAGAAAGAAGGCCAGGTGGGACACTTTAGAGCCTTTGGATACCGG
CCTGTCTTTAGCAGAGGATGAAGAGCTGGTGTTACATCTGCTAAGAAGTCAAAGCTAAAT
ACTTCCTGCGCCTGCCTTCTCCTTGAAACCTTGGTTATGACTGCGTAGGCAAGAAGTTGA
AAAACAGTTGATTTGGGGGCACTTAGGTACCATATGCCCCATTCCCAAAGGGCACATTTC
TGGATAGAAGCGATCGTATCTCCAAGTCCCTCTCACAGGACATGCTTTGTGCCATCACTG
AGCATACTCAGATCGAGGGTGGATGATACCATTTCCTGACCCCGTTTTCCAGCATGTGTT
CTGTTAGATTTTTATCCATGGGTTCCTACGCCTTGTCATTGGAAACACTGCCTTTGTCTT
ACTGGCAAGTTCTGGAGCTCTTGTGTCATTGTTAGAAATCCCTGTCTTGCTTACTGTACA
GAAGTTTCTGTTGCTGTTAAAATTGCTCATGATTTCGACGTATTTAATATTTTCAAAGAG
ACTATGATGGACCAGCCCTGAGAAAGAATGAGTATTTTTGAATTGAGATGATCAATAATA
AACATATTTCCTAT
aaaagaaagtattaatgtttgcattgtgtccagtaacataagagacctctcacaggaagg
ttcttaagattaaagtgcttggccatttcctcaaactgtgaatttgtcatattcttaagt
tagcctgttctcaaggatatcatttaacttaacacttgcaggtttgctagcaattgttta