Gene CTSF Variant 1
DNA : 5.11 KbNT_033903
mRNA : 2009 bp NM_003793
CDS : 1455 bp NP_003784
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  303 bp
ggcatatcatgcctaacatataacaagcacgtgatagaggtcagtgactagctttagcct
caggccagcagcctcccgctctccctaccctgcgcgccccacgtgcctcctgtaaacaag
agaacgcgcaggcgccgcaaaccagcgcccattggtcggcgtgccgtcgccccgctggag
GGAGGACTCAGGCCCCGCTGGCCGCGGGCTCGGTACCCGGTGGGTCGGTGGAGCGTCTGT
TGGGTCCGGGCCGCCGGCTTCGCCCTCGCCATGGCGCCCTGGCTGCAGCTCCTGTCGCTG
CTGGGGCTGCTCCCGGGCGCAGTGGCCGCCCCCGCCCAGCCCCGAGCCGCCAGCTTTCAG
GCCTGGGGGCCGCCGTCCCCGGAGCTGCTGGCGCCCACCCGCTTCGCGCTGGAGATGTTC
AACCGCGGCCGGGCTGCGGGGACGCGGGCCGTGCTGGGCCTTGTGCGCGGCCGCGTCCGC
CGG
gtgaggacgcgccgggggcgggggcgccaggcccgggtccaagggataggagctttgacc
taacattgggatggggcctgcccgctggacgaaccgatctctggtgatggggaatgggca
gcgccgcacgggcggggccttgggcgccgtcaagggccgactgtgcccgcctcacctact
EXON 2  99 bp
ccgggggcgggggcgccaggcccgggtccaagggataggagctttgacctaacattggga
tggggcctgcccgctggacgaaccgatctctggtgatggggaatgggcagcgccgcacgg
gcggggccttgggcgccgtcaagggccgactgtgcccgcctcacctactcctctctccag
GCGGGTCAGGGGTCGCTGTACTCCCTGGAGGCCACCCTGGAGGAGCCACCCTGCAACGAC
CCCATGGTGTGCCGGCTCCCCGTGTCCAAGAAAACCCTG
gtgagtgatgaggctcttggggttccccgccccgaggccgagtaaagcagcagttggatg
atgacgggtcaggtcaagacgcagggatctgaggtagctgctgccccaccttgagccact
tcccaggccccgagggctggaaaccaagatgctatgaaggggaggatgccccggtgcagg
EXON 3  219 bp
aaccaagatgctatgaaggggaggatgccccggtgcaggccgtgcctcactgtccactgt
gatggggtgattgccttaggggtggctctcatctgaggagcctccagctccatcttggcc
agatcttgctccccagatccagatccaggcccccagagcagcttcttcctctccctccag
CTCTGCAGCTTCCAAGTCCTGGATGAGCTCGGAAGACACGTGCTGCTGCGGAAGGACTGT
GGCCCAGTGGACACCAAGGTTCCAGGTGCTGGGGAGCCCAAGTCAGCCTTCACTCAGGGC
TCAGCCATGATTTCTTCTCTGTCCCAAAACCATCCAGACAACAGAAACGAGACTTTCAGC
TCAGTCATTTCCCTGTTGAATGAGGATCCCCTGTCCCAG
gtgaggagccctcagcttgaggagccctcagcttgaggagccagccgctgcctcatcacc
cttctcccttccctctggagtgggtttctctggtcagcctaaagactggtctgcctatcc
aggacttgcctgtgaagatggcttcaatcttcaagaactttgtcattacctataaccgga
EXON 4  76 bp
cagaaacgagactttcagctcagtcatttccctgttgaatgaggatcccctgtcccaggt
gaggagccctcagcttgaggagccctcagcttgaggagccagccgctgcctcatcaccct
tctcccttccctctggagtgggtttctctggtcagcctaaagactggtctgcctatccag
GACTTGCCTGTGAAGATGGCTTCAATCTTCAAGAACTTTGTCATTACCTATAACCGGACA
TATGAGTCAAAGGAAG
gtgaggacccagccttggctgtacctgttcctatcagaacaggactttccccccaacttg
gcaccttggtgtgtgggaggagaaagacaagaggcagtgtacctgttcaaggaccccata
attcctgagctctccctaagccttcccagcctggcagccaccctgagtacctggcccctt
EXON 5  114 bp
ctgggaagtcatcacttcagtttggccctaaaagttgatcagacctcccactccatcact
tgcatgtctggcccccacccctacctgctccccggggaaacccctgcctgctagccccaa
ttgcccttccttttatctgcctggggtcgaacccctcctcttctgctccttggtcctcag
AAGCCCGGTGGCGCCTGTCCGTCTTTGTCAATAACATGGTGCGAGCACAGAAGATCCAGG
CCCTGGACCGTGGCACAGCTCAGTATGGAGTCACCAAGTTCAGTGATCTCACAG
gtagggatagtggccacagtcctcatggatccaggaagagacaggaccttgctcgcaagg
cctctggtcaggtctggcttagaacactcttcctccccatgccctgcccacctttgcccg
cagaggaggagttccgcactatctacctgaatactctcctgaggaaagagcctggcaaca
EXON 6  146 bp
aggccctggaccgtggcacagctcagtatggagtcaccaagttcagtgatctcacaggta
gggatagtggccacagtcctcatggatccaggaagagacaggaccttgctcgcaaggcct
ctggtcaggtctggcttagaacactcttcctccccatgccctgcccacctttgcccgcag
AGGAGGAGTTCCGCACTATCTACCTGAATACTCTCCTGAGGAAAGAGCCTGGCAACAAGA
TGAAGCAAGCCAAGTCTGTGGGTGACCTCGCCCCACCTGAATGGGACTGGAGGAGTAAGG
GGGCTGTCACAAAAGTCAAAGACCAG
gttggacccctggaagtgagggtgggacatgggcactgcactggggctgacgaaggggcc
cggctctgactccaactccacccatctcttgtagggcatgtgtggctcctgctgggcctt
ctcagtcacaggcaatgtggagggccagtggtttctcaaccaggggaccctgctctccct
EXON 7  97 bp
tgaagcaagccaagtctgtgggtgacctcgccccacctgaatgggactggaggagtaagg
gggctgtcacaaaagtcaaagaccaggttggacccctggaagtgagggtgggacatgggc
actgcactggggctgacgaaggggcccggctctgactccaactccacccatctcttgtag
GGCATGTGTGGCTCCTGCTGGGCCTTCTCAGTCACAGGCAATGTGGAGGGCCAGTGGTTT
CTCAACCAGGGGACCCTGCTCTCCCTCTCTGAACAGG
gtgagcatctcgctctactcctctgtccccagcctagcccctcaggagggcttcttggga
ccagccttctgtctcctagagctcttggactgtgacaagatggacaaggcctgcatgggc
ggcttgccctccaatgcctactcggccataaagaatttgggtatgcattaatggggtcag
EXON 8  81 bp
gtagggcatgtgtggctcctgctgggccttctcagtcacaggcaatgtggagggccagtg
gtttctcaaccaggggaccctgctctccctctctgaacagggtgagcatctcgctctact
cctctgtccccagcctagcccctcaggagggcttcttgggaccagccttctgtctcctag
AGCTCTTGGACTGTGACAAGATGGACAAGGCCTGCATGGGCGGCTTGCCCTCCAATGCCT
ACTCGGCCATAAAGAATTTGG
gtatgcattaatggggtcaggaggggcaaccggagccacttctccctgtacaagaagtta
cttcataatgggggggagacatgagcatgagagttacacagaactgggtccaggtcttaa
tgctgacccagccaggcgtggtggctcatgcctgtaattccaacactttgggaggccaac
EXON 9  120 bp
ccccatctctcccagcctcagatgtgtcatttctagaatgaagacattcttcagagggga
tggcctgtggcctggggtggacgaggaatgtgaaacctcgcgtagagggcttagttcatt
tctggctgtgaatggcaaatgggagcctgcccttctctactcacccccaccgttccccag
GAGGGCTGGAGACAGAGGATGACTACAGCTACCAGGGTCACATGCAGTCCTGCAACTTCT
CAGCAGAGAAGGCCAAGGTCTACATCAATGACTCCGTGGAGCTGAGCCAGAACGAGCAGA

gtgagtgaggggcagggtgaggtgaggtcaggtggggccggggcctgggtgcctactgat
gccaccccttcccatctcagagctggcagcctggctggccaagagaggcccaatctccgt
ggccatcaatgcctttggcatgcaggtgaggccctagccccactgcccctgccccatctc
EXON 10  65 bp
gactacagctaccagggtcacatgcagtcctgcaacttctcagcagagaaggccaaggtc
tacatcaatgactccgtggagctgagccagaacgagcagagtgagtgaggggcagggtga
ggtgaggtcaggtggggccggggcctgggtgcctactgatgccaccccttcccatctcag
AGCTGGCAGCCTGGCTGGCCAAGAGAGGCCCAATCTCCGTGGCCATCAATGCCTTTGGCA
TGCAG
gtgaggccctagccccactgcccctgccccatctcttgttgacctccccgacctcttctt
ggagtcgatcccctactccttctccacctccagttttaccgccacgggatctcccgccct
ctccggcccctctgcagcccttggctcattgaccatgcggtgttgcttgtgggctacggc
EXON 11  91 bp
atgccaccccttcccatctcagagctggcagcctggctggccaagagaggcccaatctcc
gtggccatcaatgcctttggcatgcaggtgaggccctagccccactgcccctgccccatc
tcttgttgacctccccgacctcttcttggagtcgatcccctactccttctccacctccag
TTTTACCGCCACGGGATCTCCCGCCCTCTCCGGCCCCTCTGCAGCCCTTGGCTCATTGAC
CATGCGGTGTTGCTTGTGGGCTACGGCAACC
gtgagttccgctgcctgtcctgcatccagccaggccacaggcaggggtgggatcacagca
tctcaggtcctctagaggggaaatagggggaatgcctaggaaccctgtccttacccactg
cctgggccatgaccagctgggcatcatctgtcctctctatggcagggaagctgagctgtg
EXON 12  59 bp
gcttcctccctgccccagggcttctccctgaggctggtaggtgggcccctcgctttctgc
tcttttcctagtccctgtcacacagtaggcccagtgcaagtatttgaagggtgcaaagtg
attaaggctctgcctggagaattaaggaccctgatccttgcgctctgcactgcaccccag
GCTCTGACGTTCCCTTTTGGGCCATCAAGAACAGCTGGGGCACTGACTGGGGTGAGAAG
gtgagtcttgctggcttggcccctggccctccagccgccatcctaccctggtgccctcac
cagctccccctctcccccagggttactactacttgcatcgtgggtccggggcctgtggcg
tgaacaccatggccagctcggcggtggtggactgaagaggggcccccagctcgggacctg
EXON 13  539 bp
aattaaggaccctgatccttgcgctctgcactgcaccccaggctctgacgttcccttttg
ggccatcaagaacagctggggcactgactggggtgagaaggtgagtcttgctggcttggc
ccctggccctccagccgccatcctaccctggtgccctcaccagctccccctctcccccag
GGTTACTACTACTTGCATCGTGGGTCCGGGGCCTGTGGCGTGAACACCATGGCCAGCTCG
GCGGTGGTGGACTGAAGAGGGGCCCCCAGCTCGGGACCTGGTGCTGATCAGAGTGGCTGC
TGCCCCAGCCTGACATGTGTCCAGGCCCCTCCCCGGGAGGTACAGCTGGCAGAGGGAAAG
GCACTGGGTACCTCAGGGTGAGCAGAGGGCACTGGGCTGGGGCACAGCCCCTGCTTCCCT
GCACCCCATTCCCACCCTGAAGTTCTGCACCTGCACCTTTGTTGAATTGTGGTAGCTTAG
GAGGATGTCGGGGTGAAGGGTGGTATCTTGGCAGTTGAAGCTGGGGCAAGAACTCTGGGC
TTGGGTAATGAGCAGGAAGAAAATTTTCTGATCTTAAGCCCAGCTCTGTTCTGCCCCCGC
TTTCCTCTGTTTGATACTATAAATTTTCTGGTTCCCTTGGATTTAGGGATAGTGTCCCTC
TCCATGTCCAGGAAACTTGTAACCACCCTTTTCTAACAGCAATAAAGAGGTGTCCTTGT
cccgagtgtggtataaatgctcagtccccgggggtgaggagagatggcagggactcctgg
cgggtcaaggtgggatagctggtcctgcccaggagcctgaggggccagcttctgcttcag
gaactaaaaggagatggggagagacccagagagggatctttattcagaagcacttggctg