Gene CATSPER1 Variant 1
DNA : 9.76 KbNT_033903
mRNA : 2614 bp NM_053054
CDS : 2343 bp NP_444282
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1350 bp
tgccagtgacctgtgaggtcaccttggtctagtccttcccttttcttgacctcggtttcc
tcatttacaatgaaggagtttgacacaataattcttgattccgaactatagcccaggaag
aggcatttgggaatgaggccctggcctgctggtgacatcatagaggggagagttccacga
GAATAGTCAGGCCTTTCTGGAAGCCCAGTGCCACAGTCTGCATTGAGCTTGGCTCAGGAA
AGAAGGGAAATCCAGGCGGGGCCTGTTGGGCCCAGGTCTTGAGCTCTTTTGGCTCCAGAG
TTCCCAGCACAGTCATGGATCAAAACTCAGTGCCTGAAAAGGCTCAGAATGAGGCAGACA
CCAATAACGCAGATAGGTTCTTTCGCTCTCACTCATCACCCCCACACCACAGGCCAGGCC
ACAGCAGAGCTCTCCACCATTACGAGTTGCACCATCACGGCGTGCCCCACCAACGTGGTG
AATCTCACCACCCTCCGGAGTTCCAAGACTTCCACGACCAAGCCTTGTCCTCCCATGTCC
ACCAATCTCACCACCACAGCGAGGCACGGAATCACGGCAGAGCCCATGGCCCCACAGGCT
TTGGTCTGGCTCCCTCTCAAGGCGCCGTCCCCTCCCACCGTTCCTACGGTGAGGACTACC
ATGATGAGCTCCAACGTGATGGCAGGAGGCATCATGATGGGTCCCAATACGGTGGGTTCC
ATCAGCAGAGTGACTCCCATTACCATAGGGGGTCTCACCATGGCAGACCCCAATATCTCG
GTGAGAATTTATCCCACTATTCCTCTGGCGTGCCCCACCACGGTGAGGCTTCCCACCATG
GTGGGTCCTACCTCCCCCATGGACCCAATCCCTACAGTGAGTCCTTCCACCACAGCGAGG
CTTCCCACCTTAGCGGGCTCCAACACGATGAGTCCCAGCATCACCAAGTCCCCCACCGTG
GCTGGCCCCACCATCACCAAGTCCACCACCATGGCAGGTCCCGTCATCATGAAGCCCACC
AGCATGGAAAGTCTCCTCATCACGGAGAGACCATTTCCCCTCATTCCTCTGTGGGGTCCT
ACCAGCGTGGGATATCTGACTATCACAGCGAGTACCACCAAGGTGATCACCACCCCAGTG
AGTACCACCATGGCGACCATCCCCACCACACACAGCACCACTACCACCAGACCCACCGGC
ACCGAGACTACCATCAGCACCAAGACCACCACGGCGCGTATCATTCCAGTTACCTCCATG
GCGACTACGTCCAGAGCACTTCCCAACTCTCTATCCCACACACATCCCGGAGCCTGATTC
ACGATGCCCCCGGCCCTGCTGCTTCTCGTACAGGAGTCTTCCCCTATCACGTAGCACACC
CACGGGGCTCGGCTCACAGCATGACTCGGTCCTCCAGCACAATCCGCTCACGTGTCACCC
AGATGTCCAAAAAAGTCCATACCCAGGATATCTCCACCAAACATTCAGAAGACTGGGGCA
AAGAAGAAGGGCAATTTCAGAAACGCAAAA
gtgagtctttgctgggccccccatgccaactcctgctgcctggcgcaggatccagacctg
atctcggccccgcactgtccttccgcagatcgtaaggcccgaccctcctgcacaggtccc
ccactggctattcactctcctgactgttcatggtcccatcttttattccttgaattatgt
EXON 2  213 bp
ggcaggcacctgcagtcccagctacttgggaggctgaggcacaagagttgcttgaacccg
ggaggcagagggccagcaagcaggcaggagtgaccatggacgctgagccaggctgggggg
tgcctgggacctcgtgtcccctcttgcacacacttgactttctggccctgttcctttcag
CCGGCCGGCTCCAGCGGACCCGCAAGAAGGGACACTCTACCAATCTCTTCCAGTGGCTGT
GGGAAAAGCTAACCTTCCTCATTCAGGGCTTCCGGGAAATGATCCGGAACCTGACCCAAT
CCTTGGCCTTTGAAACTTTCATCTTCTTCGTTGTCTGCCTCAACACCGTCATGCTGGTGG
CCCAGACCTTCGCTGAAGTCGAGATCCGGGGCG
gtaagagccagggagtcctgttcccatggagaagccaccgatgctcttccaggacctccg
tgggcctgatccagtgccgggcggtttataggactcagctcacttgatcctcacccctgg
gaagtagatggccttacccagtattagagagcgtctcagaaagaccccgctgaggccggc
EXON 3  114 bp
acacaattatccccattttaaagacaagaaaactgagacacagcagtagtgaagtcgcgc
agctgcttacgcagagccggggagagcctgggaatctgggcttgtgtgaggctaatgctg
aggagagagagggcactgggtgctggggacagctctgagtgcacccctgtgttcctgcag
AGTGGTACTTCATGGCCTTGGACTCCATATTCTTCTGCATCTACGTGGTGGAAGCCCTGC
TCAAGATCATCGCCCTGGGCCTCTCGTACTTCTTTGACTTCTGGAACAATTTGG
gtgggtgcggccggggccaggctgcgtgtgtttagtctgggggaggctcgggacgagaga
aggatggggaagggggcgctggcgttgggagcccgccaggctcaggcaccccgtgccctc
agacttcttcattatggccatggccgtgctggacttcttgctgatgcagacccactcctt
EXON 4  148 bp
ctgctcaagatcatcgccctgggcctctcgtacttctttgacttctggaacaatttgggt
gggtgcggccggggccaggctgcgtgtgtttagtctgggggaggctcgggacgagagaag
gatggggaagggggcgctggcgttgggagcccgccaggctcaggcaccccgtgccctcag
ACTTCTTCATTATGGCCATGGCCGTGCTGGACTTCTTGCTGATGCAGACCCACTCCTTCG
CCATCTACCACCAAAGCCTCTTCCGGATCCTCAAGGTCTTCAAGAGCCTGCGGGCCCTGA
GGGCAATCCGGGTCCTGCGGAGGCTCAG
gtcagtggccacggctcccacctggggtggggactccaaaggaagaggggacacagacca
gggccccaaagaaatccactgtgacctgctcaagggatgggggcgcaggaggctgctgac
cccagcctgcttctgccttctgtcatgcactggaatcagccccttcatttttccagagag
EXON 5  92 bp
ttctgccttctgtcatgcactggaatcagccccttcatttttccagagaggggccaggac
tcacccaagtcaccaacaagtcaggagcctcctgccttcagcgccagctgtggctgctgg
gcagagacacacacccccgcccctcaccgatgactcagtccccactccttctgcccacag
CTTCCTGACCAGCGTCCAGGAAGTGACAGGGACCCTGGGCCAGTCCTTGCCGTCCATCGC
AGCCATCCTCATCCTCATGTTTACCTGCCTCT
gtatcctggtgctgcaggggctggggtgggggcctgaggggctgcggtgaaaggggtgcg
gggagcagggatggggcaggacgaggggcgctggggtggggatagcactggagagctgag
tttggccctgaacagccagtcctcttctccgcggtcctccgggcactgttccgcaaatct
EXON 6  144 bp
gtccatcgcagccatcctcatcctcatgtttacctgcctctgtatcctggtgctgcaggg
gctggggtgggggcctgaggggctgcggtgaaaggggtgcggggagcagggatggggcag
gacgaggggcgctggggtggggatagcactggagagctgagtttggccctgaacagccag
TCCTCTTCTCCGCGGTCCTCCGGGCACTGTTCCGCAAATCTGACCCCAAGCGCTTCCAGA
ACATCTTCACCACCATCTTCACCCTCTTCACCTTGCTCACGCTGGATGACTGGTCCCTCA
TCTACATGGACAGCCGTGCCCAGG
gtagggcaggccccaggctgcagggagggccggggattggcggggtggaccggccagggc
tcagtgaccccatcggcaaagtggggcttctgatgcctgcatgtccgggtatgggaaggg
agcaggtcgtggttgggggtggcgagcacagcctgactgtgccctctggcctgctccccc
EXON 7  64 bp
gggcaggccccaggctgcagggagggccggggattggcggggtggaccggccagggctca
gtgaccccatcggcaaagtggggcttctgatgcctgcatgtccgggtatgggaagggagc
aggtcgtggttgggggtggcgagcacagcctgactgtgccctctggcctgctccccctag
GCGCCTGGTACATCATTCCCATCCTCGTAATTTACATCATCATCCAGTACTTCATCTTCC
TCAA
gtgaggactcacccctgctctgctgcccagcaccacccacacttcctcctctcccctggg
acccttaccccagccctctcaccctggtcatgccacgctgaacccacaagaagtaccggg
tgcccctctcctctggcctcctcgctgagggcacacccctgtccctctccccagcctggt
EXON 8  73 bp
cctcaagtgaggactcacccctgctctgctgcccagcaccacccacacttcctcctctcc
cctgggacccttaccccagccctctcaccctggtcatgccacgctgaacccacaagaagt
accgggtgcccctctcctctggcctcctcgctgagggcacacccctgtccctctccccag
CCTGGTGATTACTGTCCTGGTGGATAGCTTCCAGACGGCGCTGTTCAAAGGCCTTGAGAA
AGCGAAGCAGGAG
gtaccgagtggggtgggacaggtggaccagatcaggaagctggaggagtgaggccagggg
cctccagggttgagcaggcctgggactctggcagatctgaggcctcttcttcccagaggg
ccgcccggatccaagagaagctgctggaagactcactgacggagctcagagctgcaggta
EXON 9  61 bp
tactgtcctggtggatagcttccagacggcgctgttcaaaggccttgagaaagcgaagca
ggaggtaccgagtggggtgggacaggtggaccagatcaggaagctggaggagtgaggcca
ggggcctccagggttgagcaggcctgggactctggcagatctgaggcctcttcttcccag
AGGGCCGCCCGGATCCAAGAGAAGCTGCTGGAAGACTCACTGACGGAGCTCAGAGCTGCA
G
gtatgggcctggcccgccctggccccacctgcccgtccgcagtgggggccagtctctcca
tccccctaacctccttccacagtcacagaattccagactcagttttagagttttagaatt
tgagactcaggaggactttagtccagaggaccctagaacaatcctcccaaagccagttaa
EXON 10  76 bp
tggggtgggtgctagacgggcaaacaaagggaactgcatcgtgctgcatgcccggagaag
caacctcctggagcagcctggccagaaactccattagcccttatcttcctgacacatggg
gttcctctgcctcctctccaaatccaggccttgacctcacccttctttctctacatccag
AGCCCAAAGAGGTGGCGAGTGAAGGCACCATGCTGAAGCGGCTCATCGAGAAAAAGTTTG
GGACCATGACTGAGAA
gtgaggagacaggaagggagcgaggcctggggtctgagggtgaggcctgggggcctggct
ggagggctggagggaaagggacattgcctgcccctctagaaggggatggagcgctgaggc
ttgtggatgagcctgtgggtgcaacgaggagaccctgggtggcttctgcacatccagagg
EXON 11  115 bp
gacttgggctctttctcatatctggaaaaggagacctcctggaaatgcaggtctgcagtc
atataaattttgtggggaggaggcaggcaagaagagcctctgggtggttctggggtgcag
taggcccagccagcaggtcagcccagcccctgtctctgcgacccccccgcccacccgcag
GCAGCAGGAGCTCCTGTTCCATTACCTGCAGCTGGTGGCAAGCGTGGAGCAGGAGCAGCA
GAAGTTCCGCTCCCAGGCAGCCGTCATCGATGAGATTGTGGACACCACATTTGAG
gtgaaccaggcaggagcgggaaggggccggcgaggggaaccccaggggcttgtagccaga
aatggctccaagtaactcccatggggatcggggaaggcaaagtctggctcattcacccac
cagtgccccactcacccctgcaggctggagaagaggacttcaggaattgaccccaggagg
EXON 12  164 bp
agccgtcatcgatgagattgtggacaccacatttgaggtgaaccaggcaggagcgggaag
gggccggcgaggggaaccccaggggcttgtagccagaaatggctccaagtaactcccatg
gggatcggggaaggcaaagtctggctcattcacccaccagtgccccactcacccctgcag
GCTGGAGAAGAGGACTTCAGGAATTGACCCCAGGAGGACACCAGATACAGACTTCAGCCC
CTGGCAGTCTGCCCACCTGGGTGCACTGGGACGGGTCCCCAGATCTGCTGGAATGATTGT
CCGGGCCCTGCAGAGCAGGGGCCCCAACAGAGTTTTTAAACCCC
aggaggctccatgtcctcactgactaggccaaggcgcagggaagggaattggtgcacaca
cacgaacgagtgtgtgcccgtgttgcatgtgaaaggagctgctcttggatcccctccagc
cctaccagcgcccgcatgctagctcagcccagcagggcattagcagcagctggagggatg