Gene CASP4 Variant 1
DNA : 25.70 KbNT_033899
mRNA : 1286 bp NM_001225
CDS : 1134 bp NP_001216
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  48 bp
tcatttttttcccccaagtcagaaactaaattccagtaattggatgccaatttgctgatg
acaaggcacttcctgataatgagtctggaattctgagcagcagtttcacaatctgtaatt
acacgtttccgccctttgcaataaggaaatacatagtttactttcatttttgactctgag
GCTCTTTCCAACGCTGTAAAAAAGGACAGAGGCTGTTCCCTATGGCAG
gtgagtccttttctgactaggagtttgggagtaggaacttagaaaacacttgatttattg
ctctgaaataaacacaagaaaggaagtgagccgatagcacacatgttgaattccttttct
tactgattgtgtgtagtttgaatcatgggacctggtgttagagatattgacggaggtcat
EXON 2  255 bp
aaattgttaaacaacctggtaggaatatgatgaatgacagaactctataggtacaagaag
acagatggtgaagtaggacatactttcagaagtatttcacattatagaactatatctaaa
gtgagggtgaaactctttaagctgtgcccatagttaaaggaatctttctatttctaacag
AAGGCAACCACAGAAAAAAGCCACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCA
CTGGTGTTTTGGATAACTTGGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAA
AGAAATATTACGATGCTAAAACTGAAGACAAAGTTCGGGTCATGGCAGACTCTATGCAAG
AGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATAT
CCCCCAATAAAAAAG
gtaagactggattttttacaatgaatgtctcaattttccctaaatctgtttaactccaag
gcctaagcagtgtcttctgtgattcccctatctttcccttcctaaactatcattttcact
aaacctatctttgtccttttagagaccacttcccttttgtggggtggaatccagtttaca
EXON 3  110 bp
gcttttctatcttttccagtaacaatacatctcctgatgtagaatactagatatgagata
caactaaaacccctatatgtgaagaaatcttcccaggacgtcttctctctcgatcttctt
aggtgataaattgggtcacagaggcagaaatcacaatttatgttctgcaatatcctgcag
CTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGC
TTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAG
gtgctatgctatctatatgaaatagaaaaaaaagaagagatatcattgctttccttcagt
gcaccatttcttacagcactaaatgattgggggtggggatgacagtaaccattttcaata
atgcttttactaagggaaagattatgtgacttcacaatgataccaatcctttctcaatcc
EXON 4  174 bp
aatttcagatatgtccggttctttccctgggttcttgagagagagaaagtcagtgtcttt
tgatacaagttagagcagagaggagctgcatgaagacttgaaaaagcaacactgataggc
ataaggaggctgaaaggagacttgagtaaattaaatttattgcatctccatatcctgcag
ATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACA
GAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAG
CTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGG
gtaagaatccctcagccgccacaaacacatacatattcaagacacatccttctaataact
acctagcttcaaagagctcaacaaggtttaacaacctttgggtgtgtgtgtgtgtgtgtg
tgtgtgtatacaaaataagagtactagactggtaaatctatgtctctttggtcctccaaa
EXON 5  235 bp
cacggccccataaagaaggaaaaataaaaccattaaacagctgtcatgactgagtaagca
ctaagtgaagcaccacgacctggatgttacatatgtttcttgtttcgctcatggtaaatc
taggagtcccctttaattgtgatgcttctctgactgaagttagacattgctcttttacag
GATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGC
ACATTCTTGGTACTCATGTCTCATGGCATCCTGGAGGGAATCTGCGGAACTGTGCATGAT
GAGAAAAAACCAGATGTGCTGCTTTATGACACCATCTTCCAGATATTCAACAACCGCAAC
TGCCTCAGTCTGAAGGACAAACCCAAGGTCATCATTGTCCAGGCCTGCAGAGGTG
gtgagtgctgagactgaacatctaacagttatgaaggtgtatgcagaggattgtgatgtt
tggtttatatttaggggcaacattcttaaacctcatccagtgtaaataaagtacattgaa
ttctaaagaaactctacctaagggtctggtataacaagaaattgtctcatcaaaattagt
EXON 6  144 bp
ctggagagaaagaaaagtggtgtgtgtgtgtgtgtgtctctctctgtgtgtgtttgtatg
tgtgtgggtctgtatgtatgaaactagtaagaatgaacattcaaaaagaacaaggtgggc
aactgtgacagccattctgtgggaggcacagcagtgtgcagaaagttaatgtctccatag
CAAACCGTGGGGAACTGTGGGTCAGAGACTCTCCAGCATCCTTGGAAGTGGCCTCTTCAC
AGTCATCTGAGAACCTAGAGGAAGATGCTGTTTACAAGACCCACGTGGAGAAGGACTTCA
TTGCTTTCTGCTCTTCAACGCCAC
gtatgtatctttcagtggcagtaagggatttgtgggcctgaggccatctttgaatgaatc
tagaaaatcaagaatccctatgaaacaatgatctgatagaatgttgtgtgctctccacat
attttacatgatcttatgtgtgccgtgagaacagattcctaaagcaacccgatacatgga
EXON 7  110 bp
ggttttctgtttacgttctgtggaaagtaggtaaatgtcaggttgtaagtgcttcctaca
aatctgtaaagataattcccaagctatgcttttctttttaaaaacattctcaaaacaaaa
atatgaacaaaaacatagtgaaagtcatagcccaaggcatacccatctgtatcattatag
ACAACGTGTCCTGGAGAGACAGCACAATGGGCTCTATCTTCATCACACAACTCATCACAT
GCTTCCAGAAATATTCTTGGTGCTGCCACCTAGAGGAAGTATTTCGGAAG
gtaagtgtctcttttctagttactcatttatttcttcaggaagaatttgtcatgattcac
tttttacttcacaatgacaatttttgtcagggaagtgaaagtagagaggtacccagtttc
tgtcattcagttgtttaaaatatggctaaggaaaagacaattccaatatatcccagcaga
EXON 8  104 bp
acatggagtggcaattctaagaggtagggtacaatgttgaggagttagaatgcccatggg
cttggttctatgaaacctgcaagctcacttcattccaggtgttgtctggtacatggtgaa
agatgctttctgagacttgaaaagagtcgtatctcatctacagcctattttctttttcag
GTACAGCAATCATTTGAAACTCCAAGGGCCAAAGCTCAAATGCCCACCATAGAACGACTG
TCCATGACAAGATATTTCTACCTCTTTCCTGGCAATTGAAAATG
gttaagtattgagagttgttggtggtatgtgaaataaataagagagtgatattggtggtt
aagttcaatgacaaatgacagctgagtacttggatggtcaaattggtgtttttgttgata
tagtctggtgattatctgctacttctttccgacttacatgtatttggattcctccaactc
EXON 9  106 bp
gctttaaattaggttttacaaagatcacattttggtgaatagactaagatgtcacagatg
gaagtcaagggaagtggcaagagcacatggaagaggatgcaagaagaatcatgatgaggg
atgggatgaaggcagcaaggggtaaccatcttgaccttctgttttttctctcccctgcag
GAAGCCACAAGCAGCCCAGCCCTCCTTAATCAACTTCAAGGAGCACCTTCATTAGTACAG
CTTGCATATTTAACATTTTGTATTTCAATAAAAGTGAAGACAAACG
aactgtgtctttttctaatagagaatataatctcaatgaaaatggtgggtgagtggaaat
gaagtggaggaagctaactggattttcgagctttatggctcatgaaatatctatacttgg
ctgatgaagaaaactgactgatttatccccaacaataggatgaaagatgttgccgaaaac