Gene CAPN5 Variant 1
DNA : 57.19 KbNT_033927
mRNA : 2373 bp NM_004055
CDS : 1920 bp NP_004046
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  86 bp
cgggccgcccaccccgccccacgggagaccacgcctccggctcgcaacgggcaaatgggc
ggaggccgcgggcggggcggggcggagccgggcccagctggccgaacccggggaatgcga
gcgccagcccccgccgcaggccagtcccagctggatctccggccagagcccgaggctgct
GCGCCGGGCGGCTGCAGCCTCCGCTCCAGCGCCCGCGCCGTGCCCTGCATCCCGGGAGCC
CGGCTGGACCCGCGGCGGCTCGGCCG
gtaggaggcgggcggagggaggcgtgtgcttctgtgtgtgtgtgtgtgtgtgtttcgggg
gggtgtgtgcgggtgcagcgcgggccagtgattgctccgggaccacgaatcagtggaggg
ggctgcacctcccgcgggcccggggggaaaggaagtgagcgctggctggggggcggggtc
EXON 2  200 bp
gagtcaggccggtcggtgtctgtcccactctgctgtataccagctgtgtgaccttgggta
ggctccacgcctcgctgagccttccgtgcctgtgccatggggctgatgatgtccgcttca
cagggcacatcagggacccagggactctgtgagtgaccgtcttcttgccttcctgtccag
GTGTTCCCCCTCCCCTCCCTGGGGCAGCAGCCACCATGTTCTCGTGTGTGAAGCCCTATG
AGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGCGCAGGAAGGTGCTCTTCGAGG
ACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGGCACGCCGGGGCCCGCCG
TCAGGTGGAAGCGACCCAAG
gtcagtgtctggtcccagctggagctgggtgagcgggcccaggcccacccacaaggctgg
gcctgcagggacatcggggtggtgggaggaggcatccctggccccaggctgctgagaaag
tgagggtgctgaaacggtgggatttgatccggatggggagcttggagaatgggctgtaat
EXON 3  132 bp
agcggggagcagatgggccctatggggccccaagtctgtggtgggaggcaggtgaatcac
catgctgatgatcacacagcaagtctgtgtctgtcacgtctgtgtctgtcatgtctcctg
ccatggggggcatccgcatgctcctccgcccctcacgctctctcctcgccttctccgcag
GGCATCTGCGAGGACCCCCGCCTCTTTGTGGATGGCATCAGCTCCCACGACCTGCACCAG
GGCCAGGTGGGCAACTGCTGGTTTGTGGCAGCCTGCTCGTCACTTGCCTCCCGGGAGTCG
CTGTGGCAAAAG
gtgaggcctcgggcagagtgggcagggtgctggggagtgtgaacgcagcctgtggccctc
actgccagacaggcggaacctgattgtggcagatgagactttcaaaagcctgtgccaggg
atggggtgggggcccccagtactggccgagcgtcggaattgccatccctcacccttcagc
EXON 4  209 bp
cctgagcctggagatggggaggattcatccgggtctcacgaaggcttgtggcagagttgg
aatccgaacccagtattcctttacattccgattcgctggaagcacacgcccccatttcct
caggaagccggacatcccctcactgtgttcccccatcctatcccccctccccctacccag
GTCATCCCAGACTGGAAGGAGCAGGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGC
ATCTTCCACTTCCACTTCTGGCGCTTCGGGGAATGGGTGGACGTGGTCATCGATGACCGG
CTGCCCACAGTCAACAACCAGCTCATCTACTGCCACTCCAACTCCCGCAATGAGTTTTGG
TGCGCCCTAGTGGAGAAGGCCTATGCCAA
gtaggtgccagcagcaggcaggtgggtgggaggcccagacgggggtggcaccggatgggc
tcctcgtggtattccgttagccagggctttaggcacagagaagtgaggggctggtgcagg
cacgcagcaggctcaaccgccaggcctgagggcatagtcagctgagcctgtgctgggtgg
EXON 5  193 bp
gccttatatgttggcccgagtgttaagaactgggttccagtgttggctccgccgtggcct
gctgcgtgactgtaacaggttgtttgacccctctgagtttcaaaaacctcccctatgagg
taaaggatgcagcctggctggggagcatgagctgggaagtctttccacattgcttcccag
ACTGGCAGGCTGTTACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTT
CACGGGTGGTGTTTCTGAGCCCATCGACCTGACCGAGGGTGACTTTGCCAACGATGAGAC
TAAGAGGAACCAGCTCTTTGAGCGCATGTTAAAGGTGCACAGCCGGGGCGGCCTCATCAG
TGCCTCCATCAAG
gtgagaacacggcagtccccagaggcgacccctccccttcaccctcgctgactgagatgg
gagacaactgtgacatcccacgctcaggtcagctcctacgtattcagaccctcagcctcg
tgggggaggggagaagttggaaggtgcaaccccctgcccagaccctctaggctgtgaaaa
EXON 6  194 bp
ctttactgagactgctgcccatgggggttttaaagctctgtgaacacagcactgccccat
gactgcaattcccatcccatcctgtaggtcccgtgcagcctcctagccctccagcacctg
agtccctggtctgggttccagtgtggccctgcctctctgagcaactgtgtccctccacag
GCAGTGACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCA
TACGCCGTCACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCTTCTTCAAG
TCAGAGAAGTTGGACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGG
CCCTGGAGTGACAC
gtgaggcctggggatgggggtgcaggcacagggcatgagggcttggacaaggacgggtgg
gcttcttggaggagttggcactggggctgggccttgaaggatctgggggaggatgacact
aggaacgaagaagggagaattactttgcagtggttgtatggggtgatggattgagcacaa
EXON 7  78 bp
ggagacaggcagggcttcctggagaggggctgggcatggcctcagtgcccctggccacac
cgtgccgctggaggcctggtgcaagactgcccctcgtgcctcctcgcctttgccagacag
attctggtggggctgcctcttagacagctccctttctcctccccggccctgacaccccag
CTCGGAGGAGTGGCAGAAAGTGAGCAAGAGTGAGCGGGAGAAGATGGGTGTGACCGTGCA
GGACGACGGTGAGTTCTG
gtgagtgtgtatgtgccctgggcgtccggggctgagggggcttcccacgggcctggcggg
gagcaccaggtggggagtcaggagccaggcctctcctgcatgccccatcatcaatttgct
gtgtggccttggacaagtcacaccatctcagagcctgtttcctcctctgtaaaattagtt
EXON 8  196 bp
gaggttaagggtctgtgcaatgccatgcctgtgcccttgtgtgggcttagctcccctctc
aaagccagctgtgttctctcacctctgggccatatggacatattaggttgttgggctggg
gggccaagagcctggggaggtgtgggggaggtaccctgctcagcccctccccacatccag
GATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCGTGATCAA
CACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTGGAC
GCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCTT
CTTCCAGAACCCACAG
gtgggcgttctcaggaacccccaccctgccctgtagcagctgcggggtgccttgccactg
tcctgccagggactcctgcatgaccttgggtaatccctgtccttccttgggcctcagcaa
acctgtctgtacagtgggggttagatgggcacatccgtcccatctgggggtcatgaagcc
EXON 9  123 bp
ccttcatgcagggtagccattgcaggcattggtaggcccacctcacagcagagggaccaa
ggcgcagagaggtgctgtgactggtccaggctctggagtctgagcttccgggagccagcc
agcccatgcctggtgtggtctcattgcagtgtctctctctctccttggccacacctgcag
TACATCTTCGAAGTCAAGAAGCCAGAAGATGAAGTCCTGATCTGCATCCAGCAGCGGCCA
AAGCGGTCTACGCGCCGGGAGGGCAAGGGTGAGAACCTGGCCATTGGCTTTGACATCTAC
AAG
gtgaggccagccgggtcccctgccgtgggtggggagagggagggagctggagtttggact
gcccatgcctgaggaagaacgctctagaacaccttggtcactgccgctgccctggctgcc
gtggcagacattgtgaggatgccgtggcatgggccccacttgaatattcacagagggccc
EXON 10  197 bp
ctcttcccttcagccctgggcaaacacgaatccgcttctgttattatagatttgcctgtt
ccggacatttcatataaagggattccatcgtcccttccatggtggtgagggggaggcggg
gtgggccagggtgttgtagggtgtgtctccgcgtggcccagcccctcccgcctcctgcag
GTGGAGGAGAACCGCCAGTACCGCATGCACAGCCTGCAGCACAAGGCCGCCAGCTCCATC
TACATCAACTCACGCAGCGTCTTCCTGCGCACCGACCAGCCCGAGGGCCGCTATGTCATC
ATCCCCACAACCTTCGAGCCAGGCCACACTGGCGAGTTCCTGCTCCGAGTCTTCACTGAT
GTGCCCTCCAACTGCCG
gtacttgggggctggcttgaggccagtgtgggtgggagtgacattcacactgggccaacc
aggaacctgcagcctcagagatgctcagtgtctctgggcctccagccactctgggctgat
accagtgcccatctccttcccttctcttcccttgttcccctgtcccagcatccctggcca
EXON 11  116 bp
gcaggaagcccacagggcttggagctggggactgcccatggggatttgctcaggactaaa
tgaaatcaagtttgggctaaatactgcttctcttcccttcccacttcctgaaccccctct
tcacccctgtcttcctggcccttctccatcactcccctctcccctgccgccccatatcag
GGAGCTGCGCCTGGATGAGCCCCCACACACCTGCTGGAGCTCCCTCTGTGGCTACCCCCA
GCTGGTGACCCAGGTACATGTCCTGGGAGCTGCTGGCCTCAAGGACTCCCCAACAG
gtgagctctcccagggagagtcccccggccctcctgccagttgtcccatggcctctctcc
accagcacggataccagcctcagagctctcctgctctcagaggcactgcaggcctggcca
tttctggggtgatgcctgatgctgggcacatagagaggaaaaggtttaccttctgctctc
EXON 12  137 bp
tggccagtgtgcccctgctggccggcctgtctctggaaacgaaggggccctgaggtgggt
caggctccagtctctccatctgaataactgagccgggtgggcatctcacctgtagatatc
tgtggccctgccacagcccccacccccaccctcaccccatctcccactccctctccctag
GGGCTAACTCTTATGTGATCATCAAGTGTGAGGGAGACAAAGTCCGCTCGGCTGTGCAGA
AGGGCACCTCCACACCAGAGTACAATGTGAAAGGCATCTTCTACCGCAAGAAGCTGAGCC
AGCCCATCACTGTACAG
gtgagccccctggtccagaggccacctcctgggctcctagcctgaggcttccccactcag
ggggacaagcccaggtggaagaccctctgacgaggacccaggcatgctgggctctagctg
tctgtctatccctgacccctggtgtggctttgggagctctcttgccactccaaggtccct
EXON 13  512 bp
ggctctggaaggggcaccaccttgcccgtagttcatggggaggcagacagcccagggccc
ccgatcctcagccaggcttgcacttcaaggccctgccaccaccaccagcaccccccatag
acctatattgctggtcttggaggtagcccgcccctcccatgatcctctgtctcttcccag
GTCTGGAACCACCGAGTGCTGAAGGATGAATTTCTGGGCCAGGTGCACCTAAAGGCTGAC
CCGGACAACCTCCAGGCCCTGCATACCCTCCACCTCCGGGACCGAAATAGCCGGCAGCCC
AGCAACCTGCCAGGCACTGTGGCCGTGCACATTCTCAGCAGCACCTCCCTCATGGCTGTC
TGACACCTGCCCACCTACCTGGCTCTGACCGTTCCCACCACCATCTGCATGTCCCCACTG
GGCCTGAGTCTAGCCTGGGAGCCAGGATACTGGGGTCCTTTTCCCACTCTTCCACTGACT
TGCTGTGTGACCTTAGGAAGTCTCTGCCCCTCTCTCAGCCTCAGTGTCCCGAGGGCCCCG
AAGCATTCCATTCTCGTGGAGGAGTTTCCTTGCTGAGATTTCAAATAGTCCTCCCCACCT
CAACTGTCACCACTGCTAAGGGACTCTATCCATTGAGCACATTTTCCTAAGGCCCTGCTG
TCTGCCGAGGAGCGCCAAGAAGATGTCACTTG
tttacacacgaactgccacatccccaagctccgttcttgcccctcgtgtcctaggcccaa
cccagcctcccagacctcactttccccatcagcaatacctggtgttctcccaccttgaaa
ggactcttggctcctgccgggttcctgctcaggctggaattgggaaaatatgcaggtgac