Gene ALX4 Variant 1
DNA : 45.56 KbNT_009237
mRNA : 1586 bp NM_021926
CDS : 1233 bp NP_068745
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  570 bp
ctcggctagctgtggggagggaggaaagagagagagggagagagagaggaaggggggggg
agggaggggaagagagagagaggagggagagagaggagagagacagagaaagaagagggg
gagagagagagaggccggcgtggaggggaggagggagagcgagcaggccgggcaaggagt
GCACAGCCACAGCCTCCTCGCCTCCCCAAACTCCCAGCCAAGGCGCGCGGTGGCGTCCTC
GCGCCCTCGCTCGCGTCCCCGCCCGCCGCCTGCGCAAGCCAGGCATGAATGCTGAGACTT
GCGTCTCTTACTGCGAGTCGCCGGCCGCTGCCATGGACGCCTACTACAGCCCGGTGTCGC
AGAGTCGGGAGGGCTCGTCGCCTTTTAGGGCATTTCCCGGAGGCGACAAGTTCGGCACAA
CTTTCCTGTCGGCCGCCGCCAAAGCACAGGGATTCGGGGACGCCAAGAGCCGGGCCCGTT
ACGGCGCTGGGCAGCAGGACCTGGCGACACCCCTGGAGAGTGGAGCTGGGGCGCGGGGCT
CCTTTAACAAGTTCCAGCCCCAGCCGTCGACCCCGCAGCCCCAGCCGCCGCCGCAGCCGC
AGCCGCAGCAGCAGCAGCCGCAGCCCCAGCCGCCCGCGCAACCGCATCTTTACTTGCAGC
GAGGCGCCTGCAAGACGCCCCCGGACGGCAGCCTCAAACTCCAGGAAGGCAGCAGCGGCC
ACAGCGCGGCCTTGCAGGTTCCCTGCTACG
gtgagtgcacgtgcgggtcacctggtgctggggaccacggggtgcttggcttccgcatcc
cttgaaactggtggcttgcgggaggtatgagttggcgggctgggggcggggtggtgactc
tggtcggtaaacgggatcgatcgctgcgagggagccaagggatctgttctgtctccttct
EXON 2  311 bp
cacacagcaagttaatggcaagccagaattagaagccaagtctccggacctcgcatccaa
tgagctctaagaggaaaaaggcagggggtggctacccgagtgccccactctccccctgac
attccccttctcttgtttggttcaaccattggtttctgactttgtttcctcctccctcag
CTAAAGAGAGCTCCCTGGGTGAGCCAGAGTTACCCCCTGACTCTGACACTGTGGGGATGG
ACAGCAGCTACCTGAGTGTCAAGGAGGCTGGGGTGAAGGGGCCCCAGGACCGGGCCAGCT
CAGACCTCCCCAGCCCATTGGAGAAGGCCGACTCAGAGAGCAACAAGGGCAAGAAGCGGC
GGAACCGGACCACCTTCACCAGCTACCAGCTGGAGGAGCTGGAGAAGGTCTTCCAGAAGA
CCCACTACCCAGACGTGTATGCGCGGGAACAGCTGGCCATGAGGACAGACCTCACTGAGG
CCCGCGTGCAG
gtcagtgagggccacctgggagtgaggctggtaaagcagagcctgtccctgggctcttgg
ctgcagttggggtctcctgactgcccaccaaccacaccatggctttcctttcctcagttc
attgagaacctgaaagtgggggctcctagcctgcccctcatgcccctgtcccaactagag
EXON 3  129 bp
gattctagattgtcagctcttgaggacaaagaccaaggttgatatttatgtgtggccgca
ccgtttcccaaacgcactgcaactgatggggggctcaagggaacagtttgcactgcctga
aagtgaggcctccaggcgggcatctcaccctggtgacaatggctttttcgcgtcttgtag
GTCTGGTTCCAGAACCGAAGGGCCAAGTGGAGGAAGCGGGAGCGTTTTGGGCAGATGCAG
CAGGTTCGAACCCACTTCTCCACTGCATATGAGCTGCCCCTCCTCACCCGAGCTGAGAAC
TACGCCCAG
gtaagtcccgccctgagctgccgccaccgatccccagcccctggtgctctgagaatgagc
cccttggaggagagcccaggcaccccgagatgacttatggctccaggctgcccttccgtc
tcattccaggggtgtgcctgtttataccagagtgtgggaggcccagggttaatctatcca
EXON 4  576 bp
tgccaaggtgtaaaagccacccccacaggggtatctggatgtccatcaaggctaaacact
caagaggggcttcatgggaaggatggacagtgaggggagaggtgctctgggggaaggggc
gagccccttccacaccacacctgcccgccagccggtgacatctctcccttcctctcccag
ATTCAGAACCCGTCCTGGCTCGGCAACAACGGGGCTGCCTCACCAGTGCCAGCCTGCGTG
GTCCCCTGCGACCCGGTGCCTGCCTGCATGTCCCCTCATGCCCACCCCCCTGGCTCTGGG
GCCAGCAGCGTCACCGACTTCCTGAGTGTGTCTGGGGCTGGCAGTCACGTGGGCCAGACG
CACATGGGCAGCCTGTTTGGAGCAGCCAGCCTCAGCCCAGGCCTCAATGGCTACGAGCTC
AACGGCGAGCCGGACCGCAAGACCTCGAGCATCGCGGCCCTCCGCATGAAGGCCAAGGAG
CACAGTGCGGCCATTTCCTGGGCCACATGACAGGGCACCCCTGCCCCGTCCCCACCTCGG
GACACCATGGGCCACGCCCATGTTTTCCAGGCCCCCAGCCTCCCACTCGACTTTCCTCTT
AGGAACCTGGCCTGGGCCAGGGGCCTGACCCTCAGCACTTTCAGCCGCCCCAAGTCTGAG
GCCCCGTGGACTGCTGGGAGGGAGGGGGCAGCAGGCCCCTGGCCCCTCCCTGGCACTGAG
GCCCTGACCCCTGCTCCCGGCCACAGGCAGTGGAGA
aagccaggtggccacgtttttcagcttcgcatccatgataagctgaaagcgctttcttgc
tcccgcccactcctctgctctgcctagttgaccatgagtcaatgctagatttccatgcag
acccagcagcctcaccagcccagtcttgtccatccttcccgctcctagtggggtcccctg