Gene ADAMTS15 Variant 1
DNA : 24.85 KbNT_033899
mRNA : 2853 bp NM_139055
CDS : 2853 bp NP_620686
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  957 bp
gccgggtgcacgctcgccgccctgggaggagtctccctcccttggctctcctttctggga
actgccggctgtcccgtagcgttggcggttccagagtgcgggctgcacggagaccgcggc
agcggccggagagcccggcccagccccttcccacagcgcggcggtgcgctgcccggcgcc
ATGCTTCTGCTGGGCATCCTAACCCTGGCTTTCGCCGGGCGAACCGCTGGAGGCTCTGAG
CCAGAGCGGGAGGTAGTCGTTCCCATCCGACTGGACCCGGACATTAACGGCCGCCGCTAC
TACTGGCGGGGTCCCGAGGACTCCGGGGATCAGGGACTCATTTTTCAGATCACAGCATTT
CAGGAGGACTTTTACCTACACCTGACGCCGGATGCTCAGTTCTTGGCTCCCGCCTTCTCC
ACTGAGCATCTGGGCGTCCCCCTCCAGGGGCTCACCGGGGGCTCTTCAGACCTGCGACGC
TGCTTCTATTCTGGGGACGTGAACGCCGAGCCGGACTCGTTCGCTGCTGTGAGCCTGTGC
GGGGGGCTCCGCGGAGCCTTTGGCTACCGAGGCGCCGAGTATGTCATTAGCCCGCTGCCC
AATGCTAGCGCGCCGGCGGCGCAGCGCAACAGCCAGGGCGCACACCTTCTCCAGCGCCGG
GGTGTTCCGGGCGGGCCTTCCGGAGACCCCACCTCTCGCTGCGGGGTGGCCTCGGGCTGG
AACCCCGCCATCCTACGGGCCCTGGACCCTTACAAGCCGCGGCGGGCGGGCTTCGGGGAG
AGTCGTAGCCGGCGCAGGTCTGGGCGCGCCAAGCGTTTCGTGTCTATCCCGCGGTACGTG
GAGACGCTGGTGGTCGCGGACGAGTCAATGGTCAAGTTCCACGGCGCGGACCTGGAACAT
TATCTGCTGACGCTGCTGGCAACGGCGGCGCGACTCTACCGCCATCCCAGCATCCTCAAC
CCCATCAACATCGTTGTGGTCAAGGTGCTGCTTCTTAGAGATCGTGACTCCGGGCCCAAG
GTCACCGGCAATGCGGCCCTGACGCTGCGCAACTTCTGTGCCTGGCAGAAGAAGCTGAAC
AAAGTGAGTGACAAGCACCCCGAGTACTGGGACACTGCCATCCTCTTCACCAGGCAG
gtgagttgatctgccgtcactttgcacccagatagtcccgttctttagggtcacctcccc
tagcgctccaaatcccctttgtatcgtgcaatgcctccgagtttaaacctcgttgatctc
ttccgactccaactctgtggagtttccagggagagccctctcccacgctccgcggagcgg
EXON 2  133 bp
gattctgtgaacagccccacaacctcctaggaagaagagcccagctggaaggtgctgggc
ctggtgaggttggaatgagatgagctggaatgtcctataggatgtcctttcttcccttca
ggtcccttctgtcactgtctctaacttcgggctggcttctgcttctcccccacccggcag
GACCTGTGTGGAGCCACCACCTGTGACACCCTGGGCATGGCTGATGTGGGTACCATGTGT
GACCCCAAGAGAAGCTGCTCTGTCATTGAGGACGATGGGCTTCCATCAGCCTTCACCACT
GCCCACGAGCTGG
gtaaggctggataagctcctcctggggtcttctgggtttgcctggggagcctggagggtg
ggagacgtgtgtctttgcccccttgtgttctgaagccttaggaccccttcttagggcaca
gtgagccttagcagcagctttgtactttttccgattgccccagccccgctggccaatgac
EXON 3  168 bp
ggaggggacagaaaacacaagaacatgatcttgaggacatttgaaagcagtctgtcgata
gttggcaatgaccagcctgaaaacctctgacatgggctttctagttcccctgccccattc
ctccctccaacccccatgtccttcctcctgccctctcagtcctcttgccttaccccacag
GCCACGTGTTCAACATGCCCCATGACAATGTGAAAGTCTGTGAGGAGGTGTTTGGGAAGC
TCCGAGCCAACCACATGATGTCCCCGACCCTCATCCAGATCGACCGTGCCAACCCCTGGT
CAGCCTGCAGTGCTGCCATCATCACCGACTTCCTGGACAGCGGGCACG
gtaagccaggacggcgggagggcaatgaggccgcctcggagggggctttgctgctgcccc
tggtggaggtgctcacttctccgtcctctgtacattaggtgtgtgtgccccctcggagcc
gggctctgacatgagtgcattcctgttgcccttggttcattatccccttaccattcagat
EXON 4  284 bp
gtggaggtgctcacttctccgtcctctgtacattaggtgtgtgtgccccctcggagccgg
gctctgacatgagtgcattcctgttgcccttggttcattatccccttaccattcagattc
tgggctagccaaacctcatcttcccagctcatcctaacgaacgccctcggctctctgcag
GTGACTGCCTCCTGGACCAACCCAGCAAGCCCATCTCCCTGCCCGAGGATCTGCCGGGCG
CCAGCTACACCCTGAGCCAGCAGTGCGAGCTGGCTTTTGGCGTGGGCTCCAAGCCCTGTC
CTTACATGCAGTACTGCACCAAGCTGTGGTGCACCGGGAAGGCCAAGGGACAGATGGTGT
GCCAGACCCGCCACTTCCCCTGGGCCGATGGCACCAGCTGTGGCGAGGGCAAGCTCTGCC
TCAAAGGGGCCTGCGTGGAGAGACACAACCTCAACAAGCACAGG
gtgagtgagtgctggagctgcgctcggggactgctgggaggagggatggagacccggggg
cctcgtctgcccttggtcttcaccaggaaggtgcctatcacagactggccacgggaccag
cactgttgcatggctgagctgtgccttcactgccctgtatatagtcctatccccttcttg
EXON 5  178 bp
ggtgggcttggtgtgcactggccatttgtttattgttttttccttcatgatacaacatta
atttcattccaggaaggtgggatgagaacttggaggctgtacagtgtagttttctatggg
ctgaggggctgggtgtggcacctggatccaccaaggaatataacaggctcttcctcacag
GTGGATGGTTCCTGGGCCAAATGGGATCCCTATGGCCCCTGCTCGCGCACATGTGGTGGG
GGCGTGCAGCTGGCCAGGAGGCAGTGCACCAACCCCACCCCTGCCAACGGGGGCAAGTAC
TGCGAGGGAGTGAGGGTGAAATACCGATCCTGCAATCTGGAGCCCTGCCCCAGCTCAG
gtgaggtggggagagcagtggtggcctgggcccaggggaggtgaggctggaggtcccccc
accccacccctactccatgtaatgcatggcctccaggtaattgggtacacaggtaattca
ggtagtctagtatttctatcatggattcctgctgatgacaaagggactgcagtcaggatt
EXON 6  182 bp
tgcgccctgggtcctttgggcccagcctgctttagtgctttcagatggggggaggttgca
gctttggtgatgagggtgggaagggctaagagagccacggcaggctgggagggaggcttg
tcctttgcaccggccttgtcccttcccctcaacttctttcttatgcttctccctccctag
CCTCCGGAAAGAGCTTCCGGGAGGAGCAGTGTGAGGCTTTCAACGGCTACAACCACAGCA
CCAACCGGCTCACTCTCGCCGTGGCATGGGTGCCCAAGTACTCCGGCGTGTCTCCCCGGG
ACAAGTGCAAGCTCATCTGCCGAGCCAATGGCACTGGCTACTTCTATGTGCTGGCACCCA
AG
gtgagtgagcctggggcctgagaacaaagtagggaccaggtcttccggggagcatcagct
gagctgccctgctcttccttctttttccccttctggggtgctgcaggtggtggacggcac
gctgtgctctcctgactccacctccgtctgtgtccaaggcaagtgcatcaaggctggctg
EXON 7  176 bp
tgtctccccgggacaagtgcaagctcatctgccgagccaatggcactggctacttctatg
tgctggcacccaaggtgagtgagcctggggcctgagaacaaagtagggaccaggtcttcc
ggggagcatcagctgagctgccctgctcttccttctttttccccttctggggtgctgcag
GTGGTGGACGGCACGCTGTGCTCTCCTGACTCCACCTCCGTCTGTGTCCAAGGCAAGTGC
ATCAAGGCTGGCTGTGATGGGAACCTGGGCTCCAAGAAGAGATTCGACAAGTGTGGGGTG
TGTGGGGGAGACAATAAGAGCTGCAAGAAGGTGACTGGACTCTTCACCAAGCCCAT
gtgagttctgggccctgaaggtcctgccagggagcaaagggagggaggtggagtttccca
gggtattggaagcttgggttagactggggtaaatgtcagatccagccagtacccttgctg
cagaggccacccatacccttctagggctgctagtccttcactcactcattcattcactca
EXON 8  775 bp
cagcagctttccagcaccaatcgccaaggggcagggacctctctgactccaaaacctgtg
cttttactcccatgccagaattcaccgaaagctaggtttactgaggaaaacagatcctgg
agcataaggtcctcaggtccaggcttctatctgatgcacggcccccctttcccccgccag
GCATGGCTACAATTTCGTGGTGGCCATCCCCGCAGGCGCCTCAAGCATCGACATCCGCCA
GCGCGGTTACAAAGGGCTGATCGGGGATGACAACTACCTGGCTCTGAAGAACAGCCAAGG
CAAGTACCTGCTCAACGGGCATTTCGTGGTGTCGGCGGTGGAGCGGGACCTGGTGGTGAA
GGGCAGTCTGCTGCGGTACAGCGGCACGGGCACAGCGGTGGAGAGCCTGCAGGCTTCCCG
GCCCATCCTGGAGCCGCTGACCGTGGAGGTCCTCTCCGTGGGGAAGATGACACCGCCCCG
GGTCCGCTACTCCTTCTATCTGCCCAAAGAGCCTCGGGAGGACAAGTCCTCTCATCCCAA
GGACCCCCGGGGACCCTCTGTCTTGCACAACAGCGTCCTCAGCCTCTCCAACCAGGTGGA
GCAGCCGGACGACAGGCCCCCTGCACGCTGGGTGGCTGGCAGCTGGGGGCCGTGCTCCGC
GAGCTGCGGCAGTGGCCTGCAGAAGCGGGCGGTGGACTGCCGGGGCTCCGCCGGGCAGCG
CACGGTCCCTGCCTGTGATGCAGCCCATCGGCCCGTGGAGACACAAGCCTGCGGGGAGCC
CTGCCCCACCTGGGAGCTCAGCGCCTGGTCACCCTGCTCCAAGAGCTGCGGCCGGGGATT
TCAGAGGCGCTCACTCAAGTGTGTGGGCCACGGAGGCCGGCTGCTGGCCCGGGACCAGTG
CAACTTGCACCGCAAGCCCCAGGAGCTGGACTTCTGCGTCCTGAGGCCGTGCTGA
gtggggtcatcgctttctccccctcactctccaccccactgatatgccagcgttctgcca
gctggagtagcgggcagaggacggtggccaggggctcacgccacgatgtcacccacatcc
ggggacaaggaccatgggctggggcgagaggttccctcctcctccctggactgggcagag