Gene ABCC8 Variant 1
DNA : 84.02 KbNT_009237
mRNA : 4977 bp NM_000352
CDS : 4746 bp NP_000343
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  274 bp
cagcgcacgcgtgcatcagggcactcacgaagccaccccggcaacatctgggagcacgcg
cctccacatctggaaggtgggcgcaagcgtagcagggccggtcgggttcctcgccgcccc
ccggccccgcaggtggtggagcagggcggggtgagggagggggaggccagcggggctggg
CGGGGCCCGGGGGGCGGGGGCCTGACGGCCGGGCCGGGCGGCGGAGCTGCAAGGGACAGA
GGCGCGGCAGGCGCGCGGAGCCAGCGGAGCCAGCTGAGCCCGAGCCCAGCCCGCGCCCGC
GCCGCCATGCCCCTGGCCTTCTGCGGCAGCGAGAACCACTCGGCCGCCTACCGGGTGGAC
CAGGGGGTCCTCAACAACGGCTGCTTTGTGGACGCGCTCAACGTGGTGCCGCACGTCTTC
CTACTCTTCATCACCTTCCCCATCCTCTTCATTG
gtgagtgcgcgcagcgagccgcggaggaggggacgggagagcagggagggaggaggaggc
gctgcgcgccgcaccgctcggcgtccccttccggcccgcgaccgccgtccgcctcgttcc
cggggtcccctgccctgtgtcctgcccgccggtccccgcactcgcacaccagctcatccc
EXON 2  142 bp
agcataggaccaggctgaatgagttggacgtttagtttgtgtgtaccagccttggggatc
ctcatgtgtaggtgtcaccctcaccatggacccaatgcccaagcacctttctggggttca
tgcaccctcttcctcctccaagtgggcaggcatcctgcctctgactgtctctccctgcag
GATGGGGAAGTCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTTCATTTCCCTG
GGCACAACCTGCGGTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATTG
CAGAGGGCATCCTGTCTGATGG
gtgagtgactgtctgaggactcaggaaagtgaatctgctccagggtacttcctgaaaggc
ccaaggagatcctagctcacctatattccacaagcccatgtcttttgttactacatccag
cagctcagtgtcttctatgtgccaacctctctgagctgggcactggacgcaagtgagtcc
EXON 3  122 bp
catgtactggcagctctgcccagcccataccccaaatacgcccattaactaaagggccct
gcagcctataaagtgatgctataaaggttcagtgttcagcctttgaaattcaaggcctgg
gctgctctattgcagtacttagcatgtccccatcctgtctgtttctctctcccatctcag
GGTGACCGAATCCCACCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGC
TGTCACCTCCGTGGTCTACTATCACAACATCGAGACTTCCAACTTCCCCAAGCTGCTAAT
TG
gtaggtgaggtgtaggagggaggggcagtaccttcattcatttcttcagataatgtttac
tgaggactcattatgtgccagctattgctctaaacagtagagatttggaatagaaaaaga
aaaaaatccctgccttcatggagcttacagtctggtgaaggaggatagacaggcaaagac
EXON 4  167 bp
tgcgtcatcttagagtcatgtactctgatatattcacacgtgcacatccacttactcgga
aatgtacacacccaggcacgcttattctgtctccttctctgccacatacttgcacacatt
atgtgagtgtacacacatgatgcacacacgtctctgcgatcttccatctctcctcggcag
CCCTGCTGGTGTATTGGACCCTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTCT
TGGACCACGCCATCGGCTTCTCGCAGCTACGCTTCTGCCTCACAGGGCTGCTGGTGATCC
TCTATGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGG
gtaagcaggccacctgggccagggtggggtgggaagcagaggctctggcctctgtcctgc
cctgggttcaggcccccaccctgcttctcagccaaactgagaagggatcagcttgtttta
cccgcccgtgtaaaggggagtggggccgtggcggaaatttcaggatagacactgcatctg
EXON 5  243 bp
gacattggtggccaagaagtgttggggaatccttttcctggtaataattacaggcgaaag
atggccccatctgttagagatcaagtgtggaatatcacaaccccagatccttgctggggc
aaggtagggagtggtgagaagttggacttacccatcccccatggcccatgtgccccacag
AGATACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCTCCCGAGGACCTGCAAGACCTG
GGGGTACGCTTCCTGCAGCCCTTCGTGAATCTGCTGTCCAAAGGCACCTACTGGTGGATG
AACGCCTTCATCAAGACTGCCCACAAGAAGCCCATCGACTTGCGAGCCATCGGGAAGCTG
CCCATCGCCATGAGGGCCCTCACCAACTACCAACGGCTCTGCGAGGCCTTTGACGCCCAG
GTG
gtcagtgggggcacagccacaccatctattcactgccttctggtttagggtcacagagag
ggacctcaaagggcattaggtcaaaatcctggtgggacaagaggggaaactgaggctggt
gaggggaagaagcttgccttaagtcacacagtgaaccagggacaggtgcagggctgagga
EXON 6  189 bp
agggccctcccaactgtgcacttgctgattccatgatctcttcctggagttcacctattt
gcagaggatgtgaccactgggtttccccagacaacaggagctaggggcatcctgggaggc
taggcccagccgtgaattagccctcaggcactctgacctggccatggtctctctgggcag
CGGAAGGACATTCAGGGCACTCAAGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGCC
TTCGGGAGGCGCCTGGTCCTCAGCAGCACTTTCCGCATCTTGGCCGACCTGCTGGGCTTC
GCCGGGCCACTGTGCATCTTTGGGATCGTGGACCACCTTGGGAAGGAGAACGACGTCTTC
CAGCCCAAG
gtaggcagccccaggggtagggtaaggcaccctctagatggttttcagttgtttctgaga
gtgcaacaggccaatgtgtgtgagccatggccacactggagtggctcctcacacatgcgc
aaagcccatagcagtatccccaccacagaatactctacatctggtcaacagaaatgccag
EXON 7  165 bp
aaaaacgtttagttggatttatcagtctgatttttcactcataaacaattgcacaagcct
ttgcaagcccagagggtcttgtaataatgatggccgtggtccattatggcacagtgatgt
gttctacggtggtcattttgctggcaatgacagtcacctctgaacttctctttccaacag
ACACAATTTCTCGGGGTTTACTTTGTCTCATCCCAAGAGTTCCTTGCCAATGCCTACGTC
TTAGCTGTGCTTCTGTTCCTTGCCCTCCTACTGCAAAGGACATTTCTGCAAGCATCCTAC
TATGTGGCCATTGAAACTGGAATTAACTTGAGAGGAGCAATACAG
gtacttggatgattattttttcactttgccataagaaccattattaggaataatgtccat
gagtgttattcatcctcatggacactcaagaataattctgctgtaaatttattttttgtt
gcccattaacgatgttttaaaacagtaaccattgacaaggcagtgtgggatagtggaaaa
EXON 8  156 bp
ttgctgtgctggagtagactagtaagttggaacggtgatacagtaccaccttacagagct
gctctagggcaccatggggactgtctgagaagcccctggcacactgtaacaggtggcatc
tggtgtggtgatgatgatgagaatgatgatgaatgtgaaacactctgctctcatttctag
ACCAAGATTTACAATAAAATTATGCACCTGTCCACCTCCAACCTGTCCATGGGAGAAATG
ACTGCTGGACAGATCTGTAATCTGGTTGCCATCGACACCAATCAGCTCATGTGGTTTTTC
TTCTTGTGCCCAAACCTCTGGGCTATGCCAGTACAG
gtactagatgggctgaggggaagggaggggggcagcaggacacacaaccagaatctgctg
gtccatggccagtaactaggagcacaccgtcttccactccatgcttgcctgtacctttca
cacacttggctataccacaggctgtacctctgggtccctcctgtcccatactctgcaagc
EXON 9  135 bp
tccttttgaaattgctttgtttctcctccttccctgcactccactccccaagataatttg
gaaacctgggcaccaaggcttgtcccactctaggggactggggaaacagggattttgcca
gcacctcctggcagggcaaccatcaggtcaaagggacctgacccatgaccccttcctcag
ATCATTGTGGGTGTGATTCTCCTCTACTACATACTCGGAGTCAGTGCCTTAATTGGAGCA
GCTGTCATCATTCTACTGGCTCCTGTCCAGTACTTCGTGGCCACCAAGCTGTCTCAGGCC
CAGCGGAGCACACTG
gtgagtgcccaaaggtgtgtgtgttttgtccctcttcccctccttccctcgacagcagca
ggtctcctcccacacacccacactgtcattgactttgactttgactttgagtaggccact
tcacctgtccaggcctcagcttctttgtctgggaaatggagtcaatgggggaggaggctg
EXON 10  163 bp
ccacttcacctgtccaggcctcagcttctttgtctgggaaatggagtcaatgggggagga
ggctgcctcccggtgaggacaggaggcgggcatggcagtgacagtattgacactcaggcc
ttcctctcgggtgggagacggagcagaagcctctcccctctgactcggggacccctgcag
GAGTATTCCAATGAGCGGCTGAAGCAGACCAACGAGATGCTCCGCGGCATCAAGCTGCTG
AAGCTGTACGCCTGGGAGAACATCTTCCGCACGCGGGTGGAGACGACCCGCAGGAAGGAG
ATGACCAGCCTCAGGGCCTTTGCCATCTATACCTCCATCTCCA
gtgagttcaccccacacagccagccctgggtgctgctgcgtacatgcaaggagagggtgt
cagagctcgggtaagagggggtgcagggacagaagcaggaggccttgagattatccgact
cagtaggggagcctcaaactggctctgatagctaagctcccagaaatcaaagtactcttc
EXON 11  41 bp
gagggaaatggggtgaggaactggaagtgccacagggctagagttctgcccctagcctac
tggagctgtgccccacaggctggccccactggactgcgctgcctccaagccatcctgggc
atctccatgtgtagctgtcacgctcctcccactaaacgcctccctgtgcttcctctgcag
TTTTCATGAACACGGCCATCCCCATTGCAGCTGTCCTCATA
gtaagtggatcctttctccatctcttgggggtagggtggagggggagggcgtctgcagtg
acaggctgcccagatttggcctttctgcacaggggcctcagaagacaggctccacagcca
gactgaaaataggatcgaaagtttatagagggtgtggcccctccccaactccagccgaac
EXON 12  146 bp
tgttggggacgtttccatgagatgactgtggggatgatgaaggtgtctccaactaaaaga
tcctcttaggagcctgctccctgacagccctctcatttcccttccagtgctgagcgtttc
cagtgtgggagggacccacaccctgggccaccctggcctcacttgtgcctctgtccacag
ACTTTCGTGGGCCACGTCAGCTTCTTCAAAGAGGCCGACTTCTCGCCCTCCGTGGCCTTT
GCCTCCCTCTCCCTCTTCCATATCTTGGTCACACCGCTGTTCCTGCTGTCCAGTGTGGTC
CGATCTACCGTCAAAGCTCTAGTGAG
gtgaggggagggtccgggcgagggcactgggcaggcaggtcctgtgtcagcctcaaggct
tgctcgagtgatggccaaaccacagctgtttggtcccggaacacacccccattgctgggc
cttgctgtagctggtcctggttggtcagagggacattggcctgtatggtttcccagctcg
EXON 13  106 bp
aaaccctggtaacaccaattacctgcccccatgcccactggtctgcccccttcagtgtgg
gctttgtgggactatacttcaggcctgagatcctgctcagagctctctatcaggctgcgc
cctctcccctcccctctgcccctggcaggggtgaggggtgtctctgtgcttcccgagcag
CGTGCAAAAGCTAAGCGAGTTCCTGTCCAGTGCAGAGATCCGTGAGGAGCAGTGTGCCCC
CCATGAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTG
gtgagtgcccggcctccccttgctactcccagcatggtcctctaaggcccaaaacttggg
cctgctgtgtcggacttctgccttttttcccaggaagaggggctcccttccctacacagc
tcccagcccagtgggtcctcacctccaaaccacccccagcccctcagggttgtgaaccgc
EXON 14  117 bp
gccagcaagtaccaggcggtggtgagtgcccggcctccccttgctactcccagcatggtc
ctctaaggcccaaaacttgggcctgctgtgtcggacttctgccttttttcccaggaagag
gggctcccttccctacacagctcccagcccagtgggtcctcacctccaaaccacccccag
CCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGC
CCACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGACAACTGCTGTGTCCAG
gtgagtcctgctgccccatgcctggccacccagcaccaactcccagagggagctcagcac
ctggaaagccagaaagctgcatgcttagtcctctgcagaggtcaccctgcctgcctgtac
ggtccataggagtccagaaaccagggaccaccaagtggggggacccccagccttaggcaa
EXON 15  76 bp
ccagccttaggcaagggtcagcatgagaaggccagtctcccactcccctgctctggaagt
gatccaggggctggaatcagtgtcttttggctttcatggaggaggggaagccagagacta
ttcactgggaactggctgcctttctgttctctcctgggcggtgggacacgcctaatgaag
ATCATGGGAGGCTACTTCACGTGGACCCCAGATGGAATCCCCACACTGTCCAACATCACC
ATTCGTATCCCCCGAG
gtatggcccagtccacccctccagcatgcccctccccatgtcccactgaataacatagag
ataaaaagacaaagctgcatttattgagcacctactctctgctcattcttggtgtatgcc
ctgggtatattatagaaggggaaggctacattctagaggcttccgtgtgctgggtgggag
EXON 16  106 bp
gaggatgttgatttccagaaggaaaggattaaagagggagaggacttgctggggattcta
ggtaggaagaaagaaaacaggggccccagggttgggtgcatctgtctgtctgtctttctg
ggtaatggttgttcagactcccccggccccactcacatctgccaccctccctccctgcag
GCCAGCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTTCTAGCCG
CACTGGGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGGAGCAG
gtaatacatgtatcctcagggcccagtggaggggaaatctccttttaaccatcctcctca
gttgaggatgcacacacatttattggagggcccactctgtgttcagtgaggactcaataa
atgctgctaatggatattctcatcatcatcactagtacgtattcacctcttactatgcgc
EXON 17  33 bp
tgtgggagggacagagattgagaagagtgctttctgaccccacagaggccatttggaaac
cctgggaatgggtgggagggttggaggtggggattgcttctcccctaagactcagcgtga
tggaaaggcaatggggtgggaactaactggtgttggtctgtcccatttgtgtcccagcag
CCTTCCTGACAGCGAGATAGGAGAGGACCCCAG
gtacagccttgggactgggtcagaagtgggtctcaacaaagggaaggggtagggtggggg
tggaggacttgtgggtgggtaatgctgagtatggattcagggatgtgcagcctacatatt
ttcagagacatggggctaaggcctgcattctcaatgagggcaaaatttggttcttgggga
EXON 18  36 bp
cttccccaagatgggcacaccccactctccacacctctctatgcagcatttgtggctaca
gactgggtccaggggattgtaaaggcatgctcatgttgggttggagggagctcaggatct
tcctggaggatatggttcactcccatgagagctcagtatgcctttcctcccctgctgcag
CCCAGAGCGGGAGACAGCGACCGACTTGGATATCAG
gtactgcgtcctgggaacattgccccccagggtcaactccctccagggtgctctcaggcc
caagggagccacatcaccctgctgggcagcccccagaccccagccccagtgttgggggag
gccagggagggcccctgtgctccaccaggtggctcgggagctgctgctgtttctgtgcat
EXON 19  99 bp
gacctctcaaacctgcctgggggaaggcaaggccaccagaggccacactaagcagatttc
taccaactgcacctccccatccccttgcctccatctgagccatcagcttgacaactgcct
ctgagaacaagcccctgagaatgccttccgcaccccctactcccgccctgctttttccag
GAAGAGAGGCCCCGTGGCCTATGCTTCGCAGAAACCATGGCTGCTAAATGCCACTGTGGA
GGAGAACATCATCTTTGAGAGTCCCTTCAACAAACAACG
gtaaaagcctgtcggagggaggcaggatgtggaggggaggaactgtctctggccagcctg
ccccagttccgggcccctccatcgatcacccacacccagccatctcactccccaggtgct
tacctgcactccagcctctccatatggtgcacctggagaggggccaggtgtgcctgagca
EXON 20  85 bp
aagtgctgacctcagctcttttcaagctcacacggtgtttgcttgcacccaagcgggagg
cctattaaagccattgctcaccctgggcatagctacccagagactaatgaccctctgcaa
gtgctcgggccaactctgaccaggctgaccagctgcatcccctgcctctacccacgccag
GTACAAGATGGTCATTGAAGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGG
AGACCAGACCCAGATTGGGGAACGG
gttagtagcagcctctgaggggttttttcaaagccaggacccccaacctaccatgccctg
agacactactcaggacaatgggtaactaggaaataggagacattgaaggctgaagagttg
cctgcagtaaggtcaaacatgttgttcttgatgatgtcctttgacaggttttcagtcctg
EXON 21  81 bp
gccctcttctgaatgaattcagtaaacacgtgcaagttccttctctatgcaaggtgagaa
gcaggcaaagaagtggatagagccaggcctccatcccaaagagctcatagtccagtaggg
tacaggacagtgtctcctgaatggctgagggcatgatgtgttcctcctctttggtgacag
GGCATCAACCTGTCTGGTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAG
CACGCCAACGTTGTCTTCTTG
gtgagtgcaagttcccttggggtcctggtctctggctgcctcccaggcctaactgcccac
ctccacctccccgcaaccccaccatcatccaacaatctccctctccaggagtaaatccct
cctgccagagatattgccttatcatcctagtgatagggaaactgaggcaggcaaggatag
EXON 22  138 bp
attttaaatgaggtaaccaaggcccagagaggttgggtgagttgtccaaagccacacagc
taactagcttcagtccctagagcagagttgatagaactctaatgggttttatactcattg
tcacccctccccaccatgcctttccctaccctctactctcttcctctcccttctgcccag
GATGACCCCTTCTCAGCTCTGGATATCCATCTGAGTGACCACTTAATGCAGGCCGGCATC
CTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGACCCACAAGCTACAGTAC
CTGCCCCATGCAGACTGG
gtgagggggaacaagggggtcaggctatagggggcagggctggggaggctgtcaggcatc
ttggcaggaaccaatccgttgtcttggtagcaactgctgagggccacaaagcataagaga
ccagcactggatggctttatgcatgctgggcatttcagggagaccctgtacaggccaggg
EXON 23  126 bp
taggagtatgttggttggggtaggttatcaataccagcccacttgcagtggatgagctgg
tggccatttgtagtgaggaaagggatgtgtcaacctccatcttagactccacaattgagg
gatgtgaccaccattcctccccagccagcccccaaaccacgtttgttgctgcctttccag
ATCATTGCCATGAAGGATGGCACCATCCAGAGGGAGGGTACCCTCAAGGACTTCCAGAGG
TCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGACAGGACCAAGAGCTG
GAGAAG
gtgggtatatccagggatggccaagcagccacccctggatgcaaaggttctgctagaacc
tgaactcataaaggtcttcctgtccttagtgccccaggaagccccctaaagggcagatgt
gggagctgggcatgaactggctcctaccagaggagagacagtacctgtgccaggtgccca
EXON 24  100 bp
tgatgaaggggaaggactaaatcctggcaagatgaatgtgtgtctgtctgcccctccctc
aggcagggacaaagtagaaatctgacattggtcatcaccagagtagttaccccttaactt
ccccttcccccaccaaccatatatcctgaagacattgcccaggccacatctgtcttttag
GAGACTGTCACAGAGAGAAAAGCCACAGAGCCACCCCAGGGCCTATCTCGTGCCATGTCC
TCGAGGGATGGCCTTCTGCAGGATGAGGAAGAGGAGGAAG
gtacaggcaatgggactgggagtgaaattatggcctgaggtctgatcagccacagagagg
ctaaggtttggggttctgggtgtggtgcagtagtgtgcctttgattaaatggcttccctc
tgtgtgcccccgttgtcccctcagtaagtggggataaaatgccctgattcaccctcagag
EXON 25  242 bp
atcagccacagagaggctaaggtttggggttctgggtgtggtgcagtagtgtgcctttga
ttaaatggcttccctctgtgtgcccccgttgtcccctcagtaagtggggataaaatgccc
tgattcaccctcagagggatggaaatgtgtagccacagagtgggttcttgcggcctgcag
AGGAGGCAGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTG
AGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGT
TGCTGGTCTTCTCACAGCTGCTCAAGCACATGGTCCTGGTGGCCATCGACTACTGGCTGG
CCAAGTGGACCGACAGCGCCCTGACCCTGACCCCTGCAGCCAGGAACTGCTCCCTCAGCC
AG
gtgtgactggcggcccatggcagaggttgggagtggggatgggggaagggctgagcccat
gggcaccctggaactccaaatcactctctgcctgtgaaggagtgcaccctcgaccagact
gtctatgccatggtgttcacggtgctctgcagcctgggcattgtgctgtgcctcgtcacg
EXON 26  167 bp
gccatcgactactggctggccaagtggaccgacagcgccctgaccctgacccctgcagcc
aggaactgctccctcagccaggtgtgactggcggcccatggcagaggttgggagtgggga
tgggggaagggctgagcccatgggcaccctggaactccaaatcactctctgcctgtgaag
GAGTGCACCCTCGACCAGACTGTCTATGCCATGGTGTTCACGGTGCTCTGCAGCCTGGGC
ATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAG
AGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGAG
gtacccgtctcccctggccaggctgggactgtgagcaagtcactgttctctgagccttag
tcttcccatctataaaatggggatatacaacctgtcacaagcttgtgggggtgactcaag
gagacagtgtgtgtaaaagtgccctccttgtgcaagaagcagggagaaactggcatttac
EXON 27  70 bp
ccctttgggcagctgcaggaattcacggggatacaggccagatgtctacaaattggcaga
ggatgccagacccatgaatgactccagagacacttacatgaaataattaactatctcatt
cagtaaacaggaagtaaatcaatggacaaatgagtaactcttcctctggctgcctcttag
GTTTTTTGAGACCACGCCCCTTGGGAGCATCCTGAACAGATTTTCATCTGACTGTAACAC
CATCGACCAG
gtacagaggaccgtgccacactatccccccttccagagacacctcggacccctgggggct
tctcctgtctgaggctgggttccccagatcaggtgatcacagccctctgggaagaagcca
gtgtccccgatccgattataatgctgcttcagggctggggcctccctcgtgggagcctca
EXON 28  158 bp
gcagaggctgccgtgaaccgagattacgctgctgcactcaagtctgggcaacagtgagac
tcagtctcaaaaaaataaaggatcaaaaaataaagtgagagcaaaacatggcggccagta
gcactctaaacacagtcaataccaaaattcacctcactctctccccctcgtctccctcag
CACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTCTGTGTCTCAGCCCTG
GCCGTCATCTCCTATGTCACACCTGTGTTCCTCGTGGCCCTCTTGCCCCTGGCCATCGTG
TGCTACTTCATCCAGAAGTACTTCCGGGTGGCGTCCAG
gtgatggcctcaggggtgaggggtgggaggtgctttgcaatgtgcagtttggtgtacttg
ctagactcatcgttatgagagtaatagggtcgtgttccctccaaaaaataaaaacaaaaa
acagaaatgaaggaaatagaaatatccacatcttattccaccgccctaatataatagtct
EXON 29  93 bp
gtgctcacaaaagctcaatgggctggtggcattgtcttcccccttcacggggtaagaagc
tgaggcctagagaggtaaggccattcacccacacagcggtagcaggtggagctaggcttc
aggcccaggccgagccctgagcctgccctcttaactgttccactctgttccccgccacag
GGACCTGCAGCAGCTGGATGACACCACCCAGCTTCCACTTCTCTCACACTTTGCCGAAAC
CGTAGAAGGACTCACCACCATCCGGGCCTTCAG
gtacgagtccacattcccccaaggtaggagtggaacaggggtggggccagggggcacagg
ccatgagatttgattctcaggactccacttgggaaggccaaggacacgttctctctcaag
ctgcctcaggtcccaaggcccaagggatatccaccagcagggacaggccaggtgggctcc
EXON 30  103 bp
tttgaataagcagaaaggagtggggtggacattccagagagggatagcttacatgaagtg
gccacggtggcatgtctggggactggaggggccctggagcctccctctgcaggtagggag
actcctaggagctatgtggaccaacactgttcccttaggagcttctcatcctccctccag
GTATGAGGCCCGGTTCCAGCAGAAGCTTCTCGAATACACAGACTCCAACAACATTGCTTC
CCTCTTCCTCACAGCTGCCAACAGATGGCTGGAAGTCCGAATG
gcaagtgctattcccctctaccctggcctctgataggagggtggggccagagcaagagca
cacaggtacctggggatgaaagagaggataggataccagatcgtgtggacaccaagcctt
cctgcttcccccagccctggtggtcctcctagtgtctagcctgtgctccttttccccata
EXON 31  114 bp
gttggctcctggggctccagccttcgcagcccttgtgtgtgtctggtgacgtgtgcatga
gttgcagggctggagtggaggcctggctgagctgctctctgccccgaaaaggagtgaggt
agaacaggggcctgtggctctaacccctgagcgcccaggtcagctcctctccctccccag
GAGTACATCGGTGCATGTGTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCTG
CACAGGGAGCTCTCTGCTGGCCTGGTGGGCCTGGGCCTTACCTACGCCCTAATG
gtgagcggcagtgggctagggcagaggaggggtcagacaccagcactcccggagcacctt
cgtcactggagacatgagacactcccaggccttaccccaatttcatttgcatctgatgcc
agagggacagtgcgggcaggaaggctgaccagcaggccccagggcccaggccccagacag
EXON 32  121 bp
gggagccacatgactgaccctccctgtgcctccagggagggctgctctgagcaggcagtg
gatggcagcaaaaggaatctggggccctggcccctctccagccttaagaagagccattct
ggtggctgaggacagaactaagcgaccatggagtgtgcgccactggcttgctccccacag
GTCTCCAACTACCTCAACTGGATGGTGAGGAACCTGGCAGACATGGAGCTCCAGCTGGGG
GCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAGAGAGCTACGAGGGGCTCCTG
G
gtgagaggctcagggagaggggtggggaagagtccaaggaggagtgtgtctgggttgggg
gccacaagggagcctggggatggggtggcactttcggatactagctgtggcccatgcctg
gtggctgagcccagcccggcccccagcaccatcgctgatcccaaagaactggccagacca
EXON 33  131 bp
aaaaccgaggcagagagctacgaggggctcctgggtgagaggctcagggagaggggtggg
gaagagtccaaggaggagtgtgtctgggttgggggccacaagggagcctggggatggggt
ggcactttcggatactagctgtggcccatgcctggtggctgagcccagcccggcccccag
CACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGA
GCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTGAAGCACGTCAATGCCCTCATCGCCC
CTGGACAGAAG
gtcagagcacgggcccaacccaatgctgcaggacaggcgtgagcaggggatggggcatgc
acggagctggatggcttcgcagtcacctcgtggccctccagggccgaggcctctcactat
tcagacatcgcagtctcctgccctgggcctgtgggggcccatctttcctctccttctatt
EXON 34  79 bp
ctggacccactgcaggaaacaagcccaaacctgtggtgtccaaagagaaactagtcagaa
aaccaggccaaaaagataccctgtgacctcccacacctgcacacacacccagagctagca
tagaggctattcccagcagccccagagtcccagtggcggtgcctgcttctctctttccag
ATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCTCTCTTGCCTTCTTCCGC
ATGGTGGACACGTTCGAAG
gtgagttgtaaggcgggcaccccacgtgtacccacagccaccagatgaggcctcagccct
ggcacgtggtcagacatgacaggaggcccagcagtcaccgccttcccctgcaccctcact
gggacccatgcagggcacatcatcattgatggcattgacatcgccaaactgccgctgcac
EXON 35  109 bp
gtcctccttctctcttgccttcttccgcatggtggacacgttcgaaggtgagttgtaagg
cgggcaccccacgtgtacccacagccaccagatgaggcctcagccctggcacgtggtcag
acatgacaggaggcccagcagtcaccgccttcccctgcaccctcactgggacccatgcag
GGCACATCATCATTGATGGCATTGACATCGCCAAACTGCCGCTGCACACCCTGCGCTCAC
GCCTCTCCATCATCCTGCAGGACCCCGTCCTCTTCAGCGGCACCATCCG
gtgagccccaccacccctcaggcccacccagccccaggccggctcagttccatcagatct
ggagcacaaagaggagggggttgggggagaccaggatcccagaggtgtttcctgctcatg
cccttctccatcccatcaggcccaggcagcctctggaaggggatcccccacccatgggtc
EXON 36  104 bp
ggaaggggatcccccacccatgggtctaagatgctgtcccccacccactgccaccacctc
ggtgcttctcccagccagacctccaactcagtctgctctcgctcactgccctctttgccg
cctggggatgcaggcaggaccctgctccctccctactggggctttctgtgccacttccag
ATTTAACCTGGACCCTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAAT
CGCCCAGCTGAAGCTGGTGGTGAAGGCACTGCCAGGAGGCCTCG
gtaactactcctggctatgcagctgggttggttgggcactcaaggaccctgtaaggatgg
cagacagaagcccgtgtctcaggtttgccccaagtttggagtctgaagcctggcaggacc
atttagtcctacttctcactatacgggggcccagagaggtcaggtgtcttgccccaggtc
EXON 37  134 bp
acggcctccacattgttgtgtcaggtgcaccagccctgcacacgcctgtgctcttggaca
cacacccacctatttgcccccatgcacacattttccaacagccccccaagccatcccatc
tgctccactcacagcacaagattaactcagtcctacttcatctccccgggctgttttcag
ATGCCATCATCACAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGCAGCTGTTCTGCC
TGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGACGAGGCCACGGCTTCCA
TTGACATGGCCACG
gttggtcctgggcccctccatgggaccatggtcttggaaagggtttagtgggatgctagg
gagaaatttgcacgaagtagtcctgaggctcaagttgcctctaacatcaaatgctatgtg
ttgcagaaaatgaaaagagctggggggaccctgactctgtctagtcttagggaatgttac
EXON 38  63 bp
caacaggctgagtccagtccctgagtgccgggaacctgttcagtcctgtggggtgggggt
gggactaggatcggggtcagatgggagctgagccacagacctgggctccacatcccccaa
gccaggccagaccccatccactgggcaggtgagccaacagctgttgcccccacttggcag
GAAAACATCCTCCAAAAGGTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTCACCATC
GCG
gtaaggggcccattgatggggtgcagagggacacccagggacaggactggcctgttgtgg
ccgtcatcagtgcacagcccctgggcttgcctggtcccagtaatcaagaaagaaccctga
agcaggcagttcagggcaaggggcctggagggcatgcagggagcctgggttgcaggattt
EXON 39  243 bp
gcagatggagagcttgtagtcacatccaccccaggaaagtgcagtccccacagtgacagg
acattctggccacatgcctcatcctcctcctccaagccgcaggagggccaccctcagctg
tggcccccaccgcgggtggtattcccaccatcctgacccgccccctcctgccctgcccag
CATCGAGTGCACACCATCCTGAGTGCAGACCTGGTGATCGTCCTGAAGCGGGGTGCCATC
CTTGAGTTCGATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTC
GTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCC
ATACCCCTGCCTGGGTTTTCTAACTGTAAATCACTTGTAAATAAATAGATTTGATTATTT
CCT
actagaggccctaagtctggtgggcaggggctggcggtggatggtgggttcagtagaacc
agcctggctctgacatcaggcagaagctgtgtgagcaaaagcctgcttccttacctgtga
aatgaggcctctattagtcagccaggctgccacaacaacatatcacagactgggtggctt