--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (119251 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (35 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1314       1382   0   Internal     69    54    Marginal
gcaccgcccgccgggggcgggggtagcggggagggactcgcgcacgccgctctgcgttga
cagtgccgggcgacacccgggccgtgccgccagcgtccgtcgggagagtgaaggctcgca
acgccttgcccgggggaaggtaacgcgccgcgcccggggctgcgcggtttgcaccgccag
GCCGAGGGCTGGGGGCCAGAAGACAAGAGAGACGGCGAGGCGCGCTCCCTGCCCGGCAGC
GACTCGGAG
gtgcgcactcgggttccagtctctacttggcccactcgctgtgttacctcgggcaacttt
gtttccctctcttggtctctgcttcctcctctgttaagtgagggaggtggtgtagaatgt
tgttccttagtctaaccagttctaaaatgggaactgcgttttggcacggggaaagctcct

Exon  2 +       6280       6410   1   Terminal    131    47    Marginal
aagaacaatttaggaaaagattgagcccctgagggctcagactttgtggtttatttctgt
atccacatagcctggcactgttcctggcactcaatgggaacttagtataagtaatttaaa
ttaattaataaatgaacaaataaaagaatgaatgaatcactctgctgaaatgtggtgcag
TGTCCTCAGATTACTGCAGTGACTTCTTCACCTATGTGAACTACCTGCAACCTACAAAAC
CACTTTCCTATGTGTTATCCCTTGTATTGATGATTGAGATAAAAGAAGGCCAAAATAAGA
GCATTTCCTAA
tcttatactttctaaacagtttgtagctactagtatagatttggtttattattccgagat
aagttgtcctctttctataaatgcatcagtaaatatttgggggtaggtagatataagacg
tagcaaacaattccacgtatttgccttctgagttagagggggaaagaaaggtatcagttg

Exon  3 +      11506      11612   1   Internal    107    65    Marginal
agccctgtgtttatgttttccggatagttgcctgctttatctatgctggagggaaaaccc
gacattacctgggttccttggggaaagccactggggagattagccttggttactagaggt
gcctcaatgtgaagacagtcacctgcatctgcacttgaactattaataatgtgtggccag
GAGCCAAGGGTGTGGAGGAGACGTGGCTCTACCGGTCAGATTCTGCAGGGGACAGATGTG
ACCCTGTTGTGGAACTGAGCACAGGTATTTGCTTGGTGTGTGAGGAA
gtgaggagggagtggatgtgtttgtttttttccttctctggcatactttttccaagtcca
ctctctcagcagccaggaactaaaagcaagtcttgggctgacattcagtgcatagggagt
aagttgtaccttttaaattcctgggggccaggcatagtggctcattcctgtaatctcagc

Exon  4 +      15668      15776   2   Internal    109    74        Good
gatatatttaagtttatttaaaagtatatatcagtcaagtctcagacctgacagatatta
ctgaatgaatgaaaagaagttgaggcaaattgcctactttcactctgtgccatcctgtgt
atagattgtggggaaacagttgatctttctttttagaagctgcatttgggatttggatag
AAAGAGACTAGAACAGAGGAGCTGGGAGGATGTGGGCTCCAGTTCCAAAGCTCATGGTAC
TCTGCAGGAGAAAGTTGAAGCCTTCTTGATTGCCCACTGTAAGATCTGG
gtgacaaagagctattggagaaggtttggttgcatttttcataatatctcagatactgtc
agagtcctaaaaatatcacttatcagaattagactcttagaaaaatgaggggcaatattt
gcctcggattcactttcattatttctctaaatcaggggaggagttcttgggacatttttc

Exon  5 +      22044      22172   0   Terminal    129    65    Marginal
ccagtctaacttttatagttatgctttatattatgcagtaaagcaagtgaagtctagaaa
tgttaagtgacttgttaaaattcatacagctagtcaggggttgtgcttgggataggctta
ggtcattctgtctcttgatattatattaggttgaaccaagtgaaattgctatttctgtag
GTCAAAACAGTTGTATACAGGTTGAGCATCTCTAATCTGAAATCCAAAATGTTCCAAAAC
CTAAACATTTTGAGCCCTGACATGACCCTACAAGTGGAAAATTCCACACCTGGCATCTTC
ACTTTCTGA
tgattcagtgtacacaaactttgttctatgcacaaaagtattaaaaatattataaaaaat
taccttcaggctgtgtgtataaggtgtatatgagacaaacgaatctgggtttagtcttgg
gtctcatccccaagatatcttatatatatgcaaatattccaaaatctgaaaaaaaatcca

Exon  6 +      29309      29385   0    Initial     77    48    Marginal
ccttctgtcatgatcgtaagtttcccgaggcctccccagccacatggaactgtaagtcca
ttaaacctttttcctttataagttacccagtctcgggtatgtctttattagcagcataag
aatggactaatacagtgatttggtactgggagtgggttgctgctgtaaagatatccaaaa
ATGTGGAAGCGGCTTTGGAACTGTGTAACAGACAGAGGTTGGAACAGTTTGGAGGGCTCT
GAAGAAGAAAGGAAAAT
gtgagaaagtttggaacttcctagagacttgttgaatggttttgaccaaaatgctgatat
tgatgtggacaacgaagtccagattgaggtggtctcagatggagatgaagaacttgttgg
gaactggagcaaagctcatcatgctttggtaaagagactggtggcattttgcccctgtct

Exon  7 +      39775      39867   0    Initial     93    75        Good
ggcattatactgagtctgagctcaggctggcctgagatataagtaaggggactggagttt
ggggaaaacaaaactggggctgggctggttgctgcccattttgatatctaatgttaaatg
gagttttagatatggttggtcattctgccttcatacgcatagtgaaggtccttctggaat
ATGACAGCTATCATGAAGGATGACTGGATTTTGCAGATTCAGAGACATAATGCCTGGGCA
GAGTTGGTGCTGACTGACTGGTGTAACTACCAT
gtaatagcaccttttatttagtaatacaaccttataggacttcatagatagcaagtcaga
tattcattaagacttattcaatgggagcatgcttgtggctatttgttttctacaagtaga
atactacttcctattgtgtctcaggaactatatatatgaagataggcgaagtaaaagcat

Exon  8 +      40553      40600   0    Initial     48    51    Marginal
gccactgcactctagcctgggtgatagagcaagatcctgtctcaaaaaatatatatatat
ataactataattatatataatattttgcactttataaaatgtctttccatgcagggtctc
atcagctccctgtggtgattcagcaaagagggtaggcagtggttagtctcaattttagag
ATGAGCAAACTAAGGCTCAAGCAAATGCTGTTGGTGGTCACCAAGCTA
gtaagtgggtaatcagatttcaaaccagatcttgtgactttaaatcttacgttctttttc
cttcatgacactgccaactagactgcggaaaaagggccagtttctcctacagtgtaaaag
tggttcagggaatgccttgaaagcgagggaattctgttgcatacacaaccaaggaatgaa

Exon  9 +      40665      40892   0    Initial    228    54    Marginal
agggtctcatcagctccctgtggtgattcagcaaagagggtaggcagtggttagtctcaa
ttttagagatgagcaaactaaggctcaagcaaatgctgttggtggtcaccaagctagtaa
gtgggtaatcagatttcaaaccagatcttgtgactttaaatcttacgttctttttccttc
ATGACACTGCCAACTAGACTGCGGAAAAAGGGCCAGTTTCTCCTACAGTGTAAAAGTGGT
TCAGGGAATGCCTTGAAAGCGAGGGAATTCTGTTGCATACACAACCAAGGAATGAAGGAG
AATCCACAGCATGGGGTTTCTAAACAGGATGGAATAAACGTGAGCTTTGTCCCCCCAGCT
CTGAAACAACAGTTGTCTGAGCTAGAACTCAGTGACATTAAACTAACG
gtatgtaacttatgctaatgaaagaaatactgatttattactttattactgttggttggg
atgaatagttgtttacattcatttacgttaattaaccaaagacagggagtcttgccaagt
ttccattttaagaattatattgaacactgatgatcgcagagatccagtgtgcttctcccc

Exon 10 +      45613      45705   1   Internal     93    59    Marginal
actcccaatttagatgtcactgtagagtgtgctgttgacagagatcgtacttctcttcaa
ggaagccttccctggctccccaagagtacattaaatcctctggttaaaagttttatagcc
cactgcctttctgctctgtgagacttcttgggcttgttcagtatctgccctcctttccag
AATCTAAACTCTCTGAGGCAGGGGACGGCATACATTATCAGAACTTCTGGCGCATACAAA
TTACCCTCTTCCAGAATGAGATCTGGGCCTGCG
gtggatgctgccattccaaggagagaggaagtttctctctggtattttgaacttaggcaa
gcctcttggtgcttcccaagctgtgtagttaataaaagcccatggatatggtggcttttg
cagcagcttcatgcaatatcagaactctgttctatgtggcttaaagtccttcgtgatatg

Exon 11 +      48051      48085   0    Initial     35    46    Marginal
agacttgggttcaaatcatatcctggttgagtagccttaggcaagttatttaacttgagc
gccagtgttctcttccatgggatgtggagaatacctatctgcatggtggtcagagtggtt
aaactaaaatatgtgtaaagggcttagcaccgcctgcgcattttttcagtctggagggaa
ATGACCAAGATCATGAGAGGCTTAGAGAACAACAT
gtgaggaacagttgagggaacaacaaagttttttatcccctcaactaagaagaggtgggg
agagcatgacatcttttttgtaaactattatgtgcaagggagaataaattaaatggggtt
caagtgggcagggtaaaatgtagccaatgtgaagaacttaggggcaagtccaaccaagtg

Exon 12 +      48317      48387   0    Initial     71    45    Marginal
gaggtggggagagcatgacatcttttttgtaaactattatgtgcaagggagaataaatta
aatggggttcaagtgggcagggtaaaatgtagccaatgtgaagaacttaggggcaagtcc
aaccaagtgagcctgagaagcggagcagcccagctgtgcagttagcagctttaggcatgg
ATGCCCTGGCAGTGTGATCTGATGATCATCGGGCTGGTACACTGGAGGGAAATCTTTCTG
CTGAGAGGGAG
gtgagcaaagagtctctgattgtcacattcaacttgttccgtctttggcttctccttcct
tccatcctttgatgctgctgtgatcctaggaagtttacaaagcatttagttttatgcaca
atggtttcgtaagtgttccggtggggatgagccttcttgttgatcagggcctttttgtct

Exon 13 +      49652      49765   1   Internal    114    68    Marginal
actggcaagagacaaacatgagtaagtagggatttgagaccgtgtgatgagtactgtgac
tgatgaagtcaggtgctaattgagcacataggaggggcacctaagctggcttggaggggt
tagggaagacttttgtgcagtaagtgacatgtaacttgagacctaacaagtattaaccag
GGAAATGCTGTTCCAGGACGAAGGAACAGCACATGCAAAAGCCTGAAGGCAAGAAGAACT
GGAAAATTTCAGAATGGCTGGAGCCTAAGGAAAAGAGCTTGGAGAGTAAAGCAG
gtgctagttcatggagagtcctacaggccgcttaaggattttgagttttagtcaatggtc
agtgggaagttggtgaaggattttaagcctgagaatgtgtcttggtcagaactgagtttt
agaaaaatgactcagcatcatgctgaatggaggatgggtaggagaggctgaacccaagga

Exon 14 +      54611      54711   0    Initial    101    91   Excellent
ttaggatcttgctatcagctgccctaaacttttgctgagccaaaataagactttgatgca
gaactgaacaagatatttcatttttgtgtgttttaatcttcctggttgcagtcttagttg
ttcagccctgagaattttgagccacatttgttgctattatttttgcatgcacttttcaaa
ATGATTGACTTAAGCTTCCTGACTGAAGAGGAACAAGAGGCCATCATGAAGGTTTTGCAG
CGGGATGCTGCTCTGAAGAGGGCCGAAGAAGAGAGAGTCAG
gtaagaggccagagaagccttgggcatgagggaaggaagaggcagtctgtacgaaaatag
gacactggggtttttttcaactataagtggtagttctgactcgaagactgaatttatgga
ttccaattttaggtttacttcctggacaaaacatttttcctcttggtgcctcttaattta

Exon 15 +      55283      55427   0    Initial    145    85        Good
attttgaaaagaaaataaattaaactagctcacatttctgcatgctttcagaaatgttgg
aattggttttaatggcaactgaaagtattctctgagccaatttttcatttgtcttgggtc
ccataaagaggagtggcaactttgatacactattcttgttgggtggaacccaaatgttcc
ATGTCAACATTCCTGCCACTTTCATTCACCTTTGTTGTCAAACAAGCACTAGGCCAGGAT
GCTGAAGAACTTGACTTTGTCCAGGCCCTGCCATTTACTGCCTGTGTAATCTTGGGCTTT
GAAGGCAGCGACAGGCTTCCTGAAT
gtaagttagtattattaattttatgattctcgctccaggagttatccaaaaggagcataa
gatatgttcttacttcctgggacacaggaccatgaataatggctttatttttaccatttc
cgtatcttgacactgatttaacgtggatgatttataaaagaacatgctagaattcacttc

Exon 16 +      56223      56268   1   Internal     46    60    Marginal
cacctggatggggctctgctgtgccttctccgcaaatggtgtgccttaaacagtgtcccc
aggagaggtgaaggattgtcactaacccaggcattagagcctcttggtagcattaatcct
ctacccattgacagtttataaagcccttttatgaatgttatcctcttatgttcttcacag
CAACCCTGACATTTGGCAAAGCAGGGACTATTGCAACCATTGAGGA
gtaagggcaggaggtgggggagcatagagaaaatattgattctttaagcataaggggaaa
tggtatttcctttaccctcccaaaagaaaagattgggggaaggacttagaaagcagtaga
gctgggactgcactgagtctctctttctacctcaggatgtgggcccctgcattttggaga

Exon 17 +      58944      59047   0   Internal    104    56    Marginal
aagtgagtgttgcacagagacatatccagttcctaaatcacttggtctgttaatggtaga
acatggactcgtacccaaggaaatagtcactggggtgtctctggggtacagctgagacaa
taacggttccagatcactgttgctaccacactgtcttttatgttgctccactacctgtag
CCACAAGTACTGGACCCAGTTATTACCATGTATCGCTACACAGCCTGCTTCCCTAACTCC
CATGTGGAGACATTTCACAGACCAGCAGTGAAGGAGACATCAGG
gtggattctttctctctcttccacccctatcctgtgtcttctctcctgctgccctgaccc
acctttaaggaaacataaccatacatacacatatgtaattttagtcttttatggtttgaa
aatcacatactcaaaaggtggcatttcctgtgctttgcgtcacactgccagcaggaaatt

Exon 18 +      63913      64064   2   Internal    152    98   Excellent
ttctctgacttttcaaaggtgaacatacacttgttagtcatctgggaagtttctgggatc
atctgaaatattaaagcttcattttatctgtgtgtttacacatgtctttatgcggtgtca
taatgaactcatttatttactgtgggttctcagcaaactaaagatcttttccttttgtag
ACATTTGCCTGAAAAAATTAAGGATGACCAGCAGCTGAAGAATATGAGTGGCCAATGGTT
TTATGAAGCCAAGGCAAAAAGGCACAGGGACAAAATCCATGGCGCAGATATCATCAGAGC
ATCTATGAGAAAGAAGAGGCCCCAGATAGCAG
gtgagttgacttggctagtgcatttacaacaagcattcgtttgggaaggaggagcgggga
gaagggaatggtgtcagaaatctgctgatggaaatcatttggatgtacacttttcataat
gtgtggccctctagtttaaatttcccttgccttggatttggatggatgagggcagagcta

Exon 19 +      66564      66699   1   Internal    136   100   Excellent
ggaatttactgacttctctcttagatgtaattctgatcaactacttagacccagtgattg
ccttggcactgggaaggcctgaggttcaggttcaaggcttcagtgataagagctgataag
agagttgtaggtcatggaggtgagagataaccttcctgtctttactgtttcctgtttcag
CTGAGCAGAGTAAAGACAGAGAAAATGGGGCAAAGGAAAGCTGGGTGAATAATGTCAACA
AAGATGCTTTCCTTCCTCCAGAGCTGGCTGGCGTTGTAGAAGAGCCAGAAGAAGATGCAG
CACCAGCAAGCCCGAG
gtaaggcaaagcttctggggagagctgctgcatgtggctttcatggcctggggtgtcaca
tgggcagaatggcaggctatgagtacagatgccagactggggtcatgggcatggggaagg
ggcagtgtatgagagaattctgggccccgatgcagataaagcccaagtggtactctttct

Exon 20 +      74680      74770   2   Terminal     91    61    Marginal
ttactctcactctggtgctgtcctgtccctgggatagggaataattctctagagaatcct
tcttattcttctgcaccagcttcctctcctagcctgctgatagctttccacttcagaggc
ataatttatgattcctcaaaaggtgaggttttattctctgaattattgtttcttttgcag
TTCCAGTGTGGTAAATCCAGCTTCCAGTGTGATTGATATGTCCCAGGAAAACACAAGGAA
ACCAAATGTGTCTCCAGAGAAGGTAGACTGA
gcccagattttgaaaatcttgtatttgttaggaatgccatttttcctcattgtgtcaaag
caccacaaaataaagagaattttgtagtacagttttttggtaccaaatacaggtaatttt
cactattttaagaagtcactagtttaagaagtcactctcatggtggaaaaagtggatgga

Exon 21 +      75228      75273   2   Terminal     46    91   Excellent
aggcttgttagttccatgtcagtccttattcctatattcctatgcatagcttcctaaatc
tctgttagagatctgcttctgggagagaattgctaatttattaaactatagacagtaaac
attgttattgattcctatattaatttttaaaacctctattgataccatttttatcattag
AATTGATGATAATAATAATGACTATGAAGCACTTCAAGATACCTAA
aatgtctccaaaatctttaggaaaggtcaattacagttgtattttgtacacttgtgatct
agcacactgagagtctggtatggtagaagaatcactggtgggactctgacctgattagag
acccaagtttcctttgaccttgatctggtctttgctatatccggggccaagttttttcac

Exon 22 +      77594      78003   1   Internal    410    64    Marginal
ctgtgctccaatgcatgaatttttaaaagcttttcacattaggcctgtagttgtgccaca
tactttactgtctttaatattttaatagtttcactaagtgtaggttaagtttatgacagg
tattttaaattatatattactctctatatgatatatcacctactgtgttttaattttcag
ATGAATTGTCAGAGTCAAAAGAAAAGTCAACTGTCGCAGATACTTCAATCCAAAAGTTAG
AGAAATCAAAGCAGACTTTGCCAGGCCTTTCAAATGGGTCCCAAATCAAGGCTCCAATCC
CCAAAGCCAGGAAGATGATCTACAAATCAACTGATTTAAACAAAGATGATAACCAGTCTT
TTCCTAGACAAAGGACAGACTCCCTGAAAGCGAGAGGGGCTCCGAGAGGGATCCTCAAGC
GCAACTCCAGTTCCAGTAGCACAGACTCAGAAACCCTTCGTTATAATCACAACTTTGAAC
CCAAAAGCAAAATTGTGTCACCTGGCCTAACCATCCATGAGAGAATTTCTGAGAAGGAGC
ATTCTTTAGAAGACAACTCTTCCCCAAACTCCCTGGAGCCATTAAAGCAT
gtgagattctctgcagtgaaggatgagcttccacagagtcctgggctaatccatggtcgg
gaagtaggagaatttagtgttttagaatctgacagattgaaaaatggaatggaagatgca
ggggacacagaagagtttcagagtgaccctaagccttctcaatacagaaagccttcgctt

Exon 23 +      81921      82028   2   Internal    108    86        Good
tgagatacgttccatcaatacctagtttattgagggtttttagcaagaagggctgttgaa
ttttttcgaaggccttttctgcatctattgagataatcatgtggtttttgtcattggttc
tgtttacgtgatggattacgtttattgatttgcatatgttgcaccagcctttcatcccag
GGATGAAGCTGACTTGATCATAGTCGATAAGCTTTTTGATGTGCTGCTGGATTCTGTTTG
CCAGTATTTTATTGAGAATGTTGGTATCAATGTTCATCAGGGATATTG
gtctgaaattttcttttcttgtgttgtctctgccagggtttggtatcaggttgatgttgg
ccccacaaaatgagttagggaggagtccctctttttctgttgtttgggatagtttcagaa
cgaatggtaccagctcctctttgtacctccggtagaattcggctgtgaatccatctggtc

Exon 24 +      84308      88336   0     Single   4029    92   Excellent
aggtctataccatgtacttccaggtctctacatttcctttcctttactgtcatagggcac
ctttggtagaataccttaattaggacaacttacattttaacccctgaaaaatgctggtat
aaacagctattggtatagaaagtgcaaatacaaagtgcttttataaagatgatgatgtga
ATGATTAACAGTTCTTTAAGCATGCTCTTTTCTTATTTAGAAAAGTATTTCTATGTTGCA
GATGAACTGTCTCATTGTGTTGAGCCTGAGCCATCTCAGGTGCCAGGTGGCAGTTCTAGA
GACCGTCAGCAAGGTAAGCCCCCTCCTCTCCCGGCTCTAAAAGCTAAGACATCTTCACGT
TCTGGTCCATATGCCACTGAGATAAAGAAGTCAACTGATGATTCCATATTTAAAGTTCTA
GACTGGTTTAACCGAAGTTCTTATTCAGATGACAATAAGTCATTCCTCCAACATCCCCGA
GGAATAGAGTCCAAAGAAAAAACAGACTCAAAATCACAGGTTGCTGTTGACTTGGTGACA
GATGACACTACTTTAAGAGAAAATGGCTCAAAGACCCTATCACCCAGCAAAATTGAATTG
AAGCCTGTGAGATCTGACTCACCATTCCAAGCAGAGGGAGATATGCTGGTTTCTGAAAGT
TGCCAAGATAATAATGTGAATATCAAATCCAAATTCATGAATTTGTCCCAAAAAGGCACC
CCAAAGGAAGGCCCAGGTATATTGCAACCATTTGAAAGCTATGGCACCCCAAGTCAAGGG
AGTAAAAATATGGACTATAGCCAAGATTCAAAAAGCCCAGGAAAAGGGAATGGGGCATCT
CCTTCAAATAGTAACTATTCCTACAGTGTTCTCAAGGAATCTGATGCAGAAAACCAAGTT
CCATGCAACACTAATAATATTGGCAACTTGGGTGAAGAAGAACCCAAGTTTCATGCTCAT
GAAGAAAATAGAGGACACTCAGAAGTGAATTTTGACTCTTCAACAGTTGTCAAAGAACCA
GGTTTGAAAGATAACATGAATGCAGAGAGAAAGAGCAAAGTAGGAAATACCTATATCCTG
AAAGCCTCCTTAGAGCCAGAGAATATTAAGTCAACACCTGGGGTTGCCAACAATGGCTCT
CCTTGGAAGAAGCCTGAGGTCCAATTCCAGCAAGAAGCTGGTGAGGTTCCCAAGAACCAA
GTGCAGAGAGAGAAATACAAAAGAGTGAGTGACAGAATATCCTTTTGGGAAGGAGAGAAA
GCTGGTGCTAAGATAACTCATGAAAAACCCACATCTTCATGTAGCCAGGAACAACCTTCT
GCTAAAGCATATCAGCCTGTGAAGAAGTCACAGGGTGTATCATCCATGGACAGTTTATCT
ACAGACCAGAGTGAATATAATCAGGCCATTCCCAAACGAGTGGTCTTAGATGAGGATGAT
CAAGCATCCCAGCTCTCCAATTCTTATTCCTCAAATAAATCTAAAGAGACCAAGCCACAA
ATAGCAGGTCCATCCAGATACTATCTTTCAGCTGAGCAATCAGATAAAGTGTCTCTGTTT
CAGAATAAGAAAAATGAGCCTATAAAAAGATCACAAGTGGCAGACAGTTTGCCTTCTAGA
AGAAACATTACTTTACCAGCACTGCAACCTCCCTCAAATGTCGGGAGTGAACGACATGCT
CCATTGGAGAAAGACAGACCTCTAGTTCGTGAATCAAATGCCAACTTTAAAGTTATGTCC
CTAAAAGAAAGAATGGATGAACCCAATGCAGAACAGGTCTATAATCCCTCTCAGTTTGAG
AATTTGAGAAAGTTTTGGGACTTAGAAGCTAATTCAAACAGTAAGGATAATGACAAGAAT
ATTACCACCACAAGCCAAAAAAATTCTGCACCTTTTAATAGGCAGAAACACAAGGAATTC
AGCGACATTAAATTATCAGGTAAAAATACCCATGAAGCAGAGGTGCTTCTAAGCCCAAAA
AAAGTTATGGCAAGAGAGGAAATGGAGAAATTAAATTCAAAGGGCATACTCCAGGTGCTA
CCAGATGAAATCACATTTCCTTTGAGTCCACTTAGAAAGTATACTTATCAGTTGCCAGGA
AATGAGTCATCAAAGGAAAATGTGGAAAAGAATACGGAAGGGATTGTTACTCCAGTGTTT
AAGGAAGAAAAGGATTACTCAGAACAAGAGATTCAAGAATCCATAATAAAAACCAATGTT
TTGTCTAAAGACTGCAAAGACACTTTTAATGACAGCTTGCAGAAACTGCTTTCAGAAACC
TCAACACCAGCAATTCAACCCTCTGGTGGAAAAGTTCATGGAAAACAAGTGCTTGAACCA
AGTGTTTCTGAAAATAGGACATGGCCTCAAAAAACAGATTTTGCTGATACTGAGGAAGAA
GTCAAAGGACCTGAGAAGATCATTAATGAGCATGTTGACAAAACAGTAGTTCATCCAAAG
GTTAAACGGAACTCTTTGACTGCTAGTCTAGACAAACTCCTGAAGGAAGCAACTGGAACT
TCACCCTCTCCCTTGCAAGCCAAGTTGGCGCCTGTTATCACTGGAACCAACTCTAAGCTG
GAAGAGGGGAGATTTTTTGGAAAAGGGATAGAACAGAGTCACAATACTTCAGCTGATAAG
AGAGAAATACTAGCTCCTTTTCCAGTGAGAGATGAAACTTTTGGAAATACAGCTCTCCTC
AAGAAAGCTGAAAGTGGTGAGTGCCAGCTAAGCACACAGAATTTGATTCAGATGGCTGCA
GAAGATTCTCATCCATTGGATCCAACTTCCCAGCTTTCCAGAAAGGGTTCTTTTGGGGAT
GTGGCCAGCCCTCCCCAAGATATGCTTTTTCCCCAGGATGCTCATCTTGTTCCCCAGGCT
AGGGTACACCCTTCTCAAACGGAAATTTCGGAGACTGTAGAGAAAGTCATTCTTCCACCC
AGACCTGTATTGAATGATGTAAGTGCTGCATTACAGAAGCTGTGTGGAGAAGTATGGTTA
AGTTATCCAGCTGGAAGGGAAGTAGGTCCTGGAGAAGTGAACCCAGAATTTCCTGAAGCA
GTACAGCCAGTATGTAGCCCCCTAAATCCTCCAGGAGTGATATCACCATGGGCTACGATG
GACACCATAGTTCCAGACAGGAAGGATTTTTATTCCTCCAATGTAGTTCCTGATAAAACT
CATGAAGTTGGATCTTATTTAGCTGCCCAAATGTCTCCATCAGACCAGACGCTTAGCTCA
TTTGCTTCCATTGTTGCTCAATATGGCAAAGGCCTCCCTCAGGAAGTGGAAGAAATTGTG
AGGGAAACAATTGTTCAACCCAAATCAGAGTTCCTCGAATTCAGTGCTGGCTTAGAAAAA
CTACTGAAGGAAGAAACTGAAACCTTCCCCTCAAAATATGAAAGTGATACAGGGAATCTT
TCTCCATCAAAGTTAATAGGTAGTACAGAGGAGCCCAGGCGAGCCACTTCTGAATGCCAT
CCTGAGGAATTAAAAGAAACAGTAGAAAAGGCCGAGGCTCCGTTAATAACTGAGAGTGCT
TTTGATGCTGGTTTTGAGAAACTTCTTAAAGAAATAACTGAAGCTCCTCCTTATCAGCCC
CAGGTGTCAGTGAGAGAAGAAACTCACGAGAAGGAGTCCTCACAGTCAGAGCAGACCAGG
TTCTTGGGGACAGTGCCCCATTTTTACAGGGCAGCCTCACAGACCTCTGAAATGAAGGAT
AAAAGTAATGGTTTGGAATCTCAAGTCAACCAATGTGATAAAATGTTGGGAGGAGACGCA
CTTGTGACTGATTTATTGGTAGATTTTTGTGGTTCCAGAAGTGGAGTTGAGATCCCTAGA
ACCCCACAACTTTATGTGGCTCATGAAATAGGGACCATTAAAACTGTAACCCCCCCAGAG
GACAGGGACAGTGAAAGTGGGGTTGCAGGGGGACAAGGGACTCTTCAGGAACCTGGCTTT
GGAGAGGCTTCTGAAGCAATTAGTGTGTCCAGAAATAGGCAACCCATTCCTCTCCTGATG
AACAAAGAAAACTCTACAAAAACAAGTAAAGTTGAATTGACTCTAGCATCGCCATATATG
AAACAAGAGAAAGAGGAAGAAAAAGAAGGTTTCTCTGAGTCTGATTTTTCAGATGGAAAC
ACCAGTTCTAATGCAGAGAGCTGGAGAAATCCTTCCAGTGAGCATTTAAAATTTTTTAAC
TCACAGTGA
gtctgctttatggaatgctgatgtaaaggatgattttttttaattgggattaatttgata
ttcttaaatgatgttaaattcttcttaccacttctgtgttcctgagactttcttaattaa
aaaaattatttatattttttaatcaaatgcattacataattcttaaatgatgttaaattc

Exon 25 +      93493      93546   1   Internal     54    66    Marginal
tggcactggctcaaggagctaatctaaagagaaagtattttggggaagacatcttggttg
cacccctcattgcatcttgactaattgcttccaactccgggggcttccagggacaatctc
attgttcttttctctccaagggtcagccatgttaaccatttgttaatttcttctgaacag
ATCAAGCAAAAGTAGATAATCAGCCAGAAGAATTAGTGCGTAGTGCTGAAGATG
gtaaatatctttatgtatttgcgtgtctgtctttgtattaacttctggggtgatttgggc
agtctccgggacgcagctgttgggtaaacagaagaacgtcatttgccactatgtggtgaa
tagtgcctaagttactataaaacagttctgatttggtacatttaatatagtttgtattct

Exon 26 +     100501     100534   0   Internal     34    54    Marginal
ctatttaataaactttagattcaaatataacaaaatttgttactgtcacttttctttctt
gtcccaggtaaatacttcctcggacatatttaaaataaatacctgtattttacttctttt
taaaaaatgtgttaaaatctaatgtgggtagaatgtataatttaatatacttaactctag
GAACAAAAAGATAAGCATAATAACACAGGAATAT
gtaaggggaagtttaaaaattttaaacattaaaaaatatatatatatggccttgagttga
aacagatgagactagcatttcttttttcctagtttaatagtgtgtcaagtaaaagatttg
atttttagagaagttaggggctgtgctaataagaggaattaaacatgatgttttggtttt

Exon 27 +     102836     103005   0   Internal    170    99   Excellent
aactctagtcatgtatatcatgtcaggttgtctttatagatatgtctttatgctatattg
aattaactgcttttataagcaagctaaagaaataatgccagcagggattatatccatgat
ccttgtgctaggtttaagaatgagatagagacaaacactatgtatttctgatgctttcag
GTGAGTGGCAGTGTGATGAGTGTTTATAGTGGAGACTTTGGCAATCTGGAAGTTAAAGGA
AATATTCAGTTTGCAATTGAATATGTGGAGTCACTGAAGGAGTTGCATGTTTTTGTGGCC
CAGTGTAAGGACTTAGCAGCAGCGGATGTAAAAAAACAGCGTTCAGACCC
gtaagtacattttagagtcacctaccttctcttagttctccaactgtcaatcttacagga
attggaaggaaataaagtaatcaagaggagggagggtatgtgttaagaggaatgtttgaa
aagttggggggaaatgctgttttattctataaattcatatgtcaaacattaaattataaa

Exon 28 +     104805     104907   2   Internal    103    86        Good
actaaaaccctttacacatttaagtataaaggtattggtaggaaaatttgttattcactg
cttttctcagtgtcatgaaataattatttctgctgtcagttttcaatgtatttaaaaaac
tagaggtggaaacataacttttattttctttgactttgtctgttcaattctccttttcag
ATATGTAAAGGCCTATTTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAAACACTCGT
AGTGAAGAAAACCTTGAATCCTGTGTATAACGAAATACTGCGG
gtatctatgaactctctctataggaaaatcctagatggtgacctgtttaccatgtcttct
ttgggtagtagctctacaggataaagtcagtcaccaagagaggagaaggaagggaataca
aatgttctgagactgttttgtttgagacaaaacaacctgaatgttgtatacgttatttca

Exon 29 +     107308     107478   0   Internal    171   100   Excellent
ggattttagctctttgaaacaagatgcttagaataagatgactttgcaatatttttggga
ctcgaaacctaacagataagaaaatttgctatatacagatgaatttctcttcatctctgt
gttataactttggcatcaagtaatgtttttcatcatttaattttcttctttgaacttcag
TATAAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAACCTGTCCATTTGGCATCGG
GATACATTTAAGCGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAAACATGGGAC
TGGGATAACAAACAGAATAAACAATTGAGATGGTACCCTCTGAAGCGGAAG
gtgagtccggaattttttgtttgtttatttggttggttgatgtggtacctagtgtatagg
aaaaagcttaattgcatttaattcagagtacagatctgtagtttgggagaattttaaact
agaggaaaaaaaagaaaggtaaaaaaggttattgggaacatgtttaaatcatttaacaca

Exon 30 +     109749     109857   0   Internal    109    58    Marginal
ttgatcatatgtggggtattgcatatgagaacgttctaggaataattggggaggatttac
ttttgcttctgatacagcaggcacagaccaccttcatttaatctgggaataaactgactt
tgaagcacaagcccagttttcatgtgatctggtctagtttttgtttgcttatattcctag
GCTAAGGCCCTTCAGAGGTTCCAACTGAAAGCCATGGGAAATAGTTCTCAAAATCAGCAT
GCATCTGATTCACCTGAAGGACTTATTAAATCACAGATTCTGGGGCTGG
gtgcggtggctctcagctttaatcccagcactttgggaggctgaggtgtggattgcttga
gtccaggagttggatggagacaagcctgaggaacgtggcaaaaccctgcctttgcaaaga
aattaaccaggcttggtggcatgcacctatagccccagctactcaagaggctgaaatggg

Exon 31 +     110906     110976   0    Initial     71    65    Marginal
tgaactcctcagaagatatcaaaagcatctcatttttaactggctaccattacgtttctg
atacatacccatattttgaaaataaagctctaaagagccagaatttgaaagtaaaaaact
atcttatgcaggtttcttatacaggtttagcatccctaattcaaaaatttcaaatccata
ATGCTCCAAAATCTGAAACTTTTTGAGTGCCGATATGATGCCGTAAGTGGAAAATTCCAC
ACCTGCTTCAT
gtgatgggttgcataaagttattaaaaatgttatataaaattaccttcaggctatgtgta
gaagatgtatatgaaacataaatgaattttgtgtttagacttgggtcccatccctaagat
atctcattacgtatatgcaaatattacgaatttcaaaaaacaaatccgaaatctgaaact

Exon 32 +     115948     116153   2   Internal    206    75        Good
gtcttttcagcatgatgtgttcctaccccctaccccactgtctgccaaaccaccaccacc
actatctctccacatcttttcctccattgtcaatctttaatagctgtgttgttatgtatt
gaaagcatgaatgttcactatcttactaaaatgctcccacaatcatgcctctttttgtag
TACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGACAAGAGCTGTAGGGAAAAC
CACCAACCCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGAAGATCTGAT
GGAAGCCTGTGTAGAGCTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGG
AGGTCTTCGTATTGGCTTTGGAACAG
gtactgtttgctacatttttaattctccatgagccaaatttttctagagatactagaggt
ttgtttgttgctttgcttcttcccagtgaaaaccgagatatcctgaaaacagatatctct
taagtatagtgaaataaatgagtaaagaaatgtcaggttgtatgccaagggctccagata

Exon 33 +     116240     116276   2   Terminal     37    71        Good
gatctgatggaagcctgtgtagagcttactgtctgggaccattacaaattaaccaaccaa
tttttgggaggtcttcgtattggctttggaacaggtactgtttgctacatttttaattct
ccatgagccaaatttttctagagatactagaggtttgtttgttgctttgcttcttcccag
TGAAAACCGAGATATCCTGAAAACAGATATCTCTTAA
gtatagtgaaataaatgagtaaagaaatgtcaggttgtatgccaagggctccagatatga
ggattaacagggtgaagtgtctctgcatatagagtttaagttattgtggcagtggcaggg
acagaaaagccttcatcactagtctgccctgcaaaaacatttatggtccttcaaggctaa

Exon 34 +     116512     116599   0    Initial     88    49    Marginal
tatgaggattaacagggtgaagtgtctctgcatatagagtttaagttattgtggcagtgg
cagggacagaaaagccttcatcactagtctgccctgcaaaaacatttatggtccttcaag
gctaaatatatgctttgagtaataacaataacatttttggagcaccagtcactgtattaa
ATGCTTCATTTACATTATTTCATTGAATCCTCACAAGTCTATGAGGTAGTTACTAATGTT
ACCCCAAAGGAACTGATAGTCCAAGAAA
gtaagtaacatagctacaaagtggcagagccaagattcaaaattgagtctgttagacact
aaagccttagtcacactaacctagagattatctagtgtcatctccaacccagtgcaggag
tcctcccaactcccttattccctgatgaattttcatctggcctttacattaacttgaaga

Exon 35 +     116996     117141   1   Terminal    146    81        Good
aacatgaagtcactcagacaattgaacagttcttccttatgttgagtctcacatctgccc
tcccagtgaagaaagctcctcctagcttccactggtggttataattagggaataactttc
cctctttcccctacccccaatgagctgtttctttctaaatgcaaagcttccttttttcag
GTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAGAGGAAGTTGCTCTCT
GGGAGAAGATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAGAATGC
TTTTGATTGCCAAGATTTCCAAATGA
gcccaaattccactggctcctccactgaaaactactaaaccggtggaatctgatcttgaa
aatctgagtaggtggacaaatatcctcactttctatctattgcacctaaggaatactaca
cagcatgtaaaagtcaatctgcatgtgcttctttgattacaaggcccaagggatttaaat

--------------------------------------------------------------------------------