--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (15443 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1266       1320   0    Initial     55    80        Good
cggcgctgtcacgttccagccgcctgactcaggccgcgcagggcggggagccgggaggcg
gtgccggcgcccgcctcggccccggaggcggcaccaggaagcgcccgccccggccggagc
cgccatgtaaccggcgccgcccggagcccgagccgcgcgggccccagcgacccgcccgcc
ATGGGGGACGAGGACGACGATGAGAGCTGCGCCGTGGAGCTGCGGATCACAGAAG
gtgggtgtggggcctgactgcggctgcccggggcaggccgggacgggtcatggaccggct
gggctcattcgccccctgtgcccacagccaacctgaccgggcacgaggagaaggtgagcg
tggagaacttcgagctgctcaaggtgctgggcacgggaggtgaggacccccatccaccgg

Exon  2 +       1408       1479   1   Internal     72   100   Excellent
ggagcccgagccgcgcgggccccagcgacccgcccgccatgggggacgaggacgacgatg
agagctgcgccgtggagctgcggatcacagaaggtgggtgtggggcctgactgcggctgc
ccggggcaggccgggacgggtcatggaccggctgggctcattcgccccctgtgcccacag
CCAACCTGACCGGGCACGAGGAGAAGGTGAGCGTGGAGAACTTCGAGCTGCTCAAGGTGC
TGGGCACGGGAG
gtgaggacccccatccaccgggcaggcgtcccaggcgcggtgcccctgacctcctgcctg
ctcactcttgggcctgggccaggccactgagcaggccccccaccctttcccggcacagcc
tgccttgcctgccccgccctgcctcgccagagtttgcatgcccacttccagggcactcca

Exon  3 +       2193       2411   1   Internal    219   100   Excellent
ctcccggggtgtgcacaccctttccttagaaggctctgccagctttttgcacacctgcct
gttgccccagctccttcgcctcatttgcacaccctcctgggttggcatcgcccccacccc
ccaagcctgcaccaatctcccgctcacagcccaccctccacccactcgctgctcccacag
CCTACGGCAAGGTGTTCCTGGTGCGGAAGGCGGGCGGGCACGACGCGGGGAAGCTGTACG
CCATGAAGGTGCTGCGCAAGGCGGCGCTGGTGCAGCGCGCCAAGACGCAAGAGCACACGC
GCACCGAGCGCTCGGTGCTGGAGCTGGTGCGCCAGGCGCCCTTCCTGGTCACGCTGCACT
ACGCTTTCCAGACGGATGCCAAGCTGCACCTCATCCTGG
gtgagcgcacaccacatcccaacggggttggggtggctgggggcaggcgaggccacctga
cggggctgcttcctgacttccactgcacctcccagactatgtgagcggcggggagatgtt
cacccacctctaccagcgccagtacttcaaggaggctgaggtgcgcgtgtatgggggtga

Exon  4 +       2507       2622   1   Internal    116    97   Excellent
gtgctggagctggtgcgccaggcgcccttcctggtcacgctgcactacgctttccagacg
gatgccaagctgcacctcatcctgggtgagcgcacaccacatcccaacggggttggggtg
gctgggggcaggcgaggccacctgacggggctgcttcctgacttccactgcacctcccag
ACTATGTGAGCGGCGGGGAGATGTTCACCCACCTCTACCAGCGCCAGTACTTCAAGGAGG
CTGAGGTGCGCGTGTATGGGGGTGAGATCGTGCTGGCCCTGGAACACCTGCACAAG
gtgggtgaagacctggccgcaggctgttgctatggaaactgggtctgtgccttggaagga
atctgcacgcagggcagcctcaggcttccccctgggcttcctggggggccagtggtgagc
tgggtgggaattggagctgcttcccctggaccccttgcaggaagcctcaacgttgcctgg

Exon  5 +       3164       3271   0   Internal    108   100   Excellent
ctccttctttgttttatatcttaaatggcctttcttattcagtggctctgccctggagac
cccctctacaggcagatgactttctctggggggtctccttatcctgagcagggccaggag
ctggaggagctggggagggtttcggggaggaagcctcagcacccctcttgctcctaccag
CTCGGCATCATTTACCGAGACCTGAAACTGGAGAATGTGCTGCTGGACTCCGAGGGCCAC
ATTGTCCTCACGGACTTCGGGCTGAGCAAGGAGTTCCTGACGGAGGAG
gtgagtggaggccacctctgcctgcagtgccccattcaatccttctccttcctgcctctt
cctgctctgggcctgcattctggggctgcagaagtgaatagctccaagaagtttccacag
ctcagctctccaacctcacaagttgagcgagtcttactctgggccttgtggggcactggg

Exon  6 +       3499       3579   0   Internal     81   100   Excellent
cttcctgcctcttcctgctctgggcctgcattctggggctgcagaagtgaatagctccaa
gaagtttccacagctcagctctccaacctcacaagttgagcgagtcttactctgggcctt
gtggggcactggggcacaggagaggtttcgacatctaagcaggacctcttgccctcccag
AAAGAGCGGACCTTCTCCTTCTGTGGCACCATCGAGTACATGGCCCCCGAAATCATCCGT
AGCAAGACGGGGCATGGCAAG
gtaggttggcagggaagtggggctgggggaggtggaaaggtggggtgtgaggcaggggag
atgcaggccctcaccccggctccacccggcaggctgtggactggtggagcctgggcatct
tgctcttcgagctgctgacgggggcctcgcccttcaccctggagggcgagaggaacacgc

Exon  7 +       3672       3775   0   Internal    104    96   Excellent
ctcccagaaagagcggaccttctccttctgtggcaccatcgagtacatggcccccgaaat
catccgtagcaagacggggcatggcaaggtaggttggcagggaagtggggctgggggagg
tggaaaggtggggtgtgaggcaggggagatgcaggccctcaccccggctccacccggcag
GCTGTGGACTGGTGGAGCCTGGGCATCTTGCTCTTCGAGCTGCTGACGGGGGCCTCGCCC
TTCACCCTGGAGGGCGAGAGGAACACGCAGGCTGAGGTGTCTCG
gtgagtagggctggacgtggagggcggccagagggctgcagggcctgcctgggcagggct
gtgggtggggggcttgctgcccctgacacccccccaatcctcccagacggatcctgaagt
gctcccctcccttcccccctcggatcgggcccgtggcgcaggacctgctgcagcggctgc

Exon  8 +       3882       4032   2   Internal    151    94   Excellent
ctcttcgagctgctgacgggggcctcgcccttcaccctggagggcgagaggaacacgcag
gctgaggtgtctcggtgagtagggctggacgtggagggcggccagagggctgcagggcct
gcctgggcagggctgtgggtggggggcttgctgcccctgacacccccccaatcctcccag
ACGGATCCTGAAGTGCTCCCCTCCCTTCCCCCCTCGGATCGGGCCCGTGGCGCAGGACCT
GCTGCAGCGGCTGCTTTGTAAGGATCCTAAGAAGCGATTGGGCGCGGGGCCCCAGGGGGC
ACAAGAAGTCCGGAACCATCCCTTCTTCCAG
gtgaggctgactcagggccccatacctcctggtgcatacccaggtggggctgctgttcca
ggttgaggttgtgcctggccagtttcactttatttggaaatccccccagagaaagaaagc
aagtgtgtgtcagctaggtttctcttcacatccatccccactgaaacttggcagatgtgt

Exon  9 +       7331       7495   0   Internal    165   100   Excellent
gaatagggattgtgttaccagagggagagagaagccagggaggcaggaggaacagctgcc
caccccaaatgccagatgggcccttgcctcatggaggaactgcccagtgagggtgggctg
agtggagggagtttctcgttcctggcctttgacacctgacctctgattcccttccctcag
GGCCTCGATTGGGTGGCTCTGGCTGCCAGGAAGATTCCAGCCCCATTCCGGCCCCAAATC
CGCTCAGAGCTGGATGTGGGCAACTTTGCGGAGGAATTCACTCGGCTGGAGCCTGTCTAC
TCACCCCCTGGCAGCCCCCCACCTGGGGACCCCCGAATCTTTCAG
gtgaggggaaactcatggaacccagatgcaggagagatgagatgttgctgtctgcctcag
ccctggctggcccgaggacactgcctaggccttgtgtcctgattgggactcagcgtctcc
cctagacgtcgccacttcagtgggacctagggttgtcagtcacagagaccacccaggcag

Exon 10 +      10162      10290   0   Internal    129    81        Good
tataaaaccaggtggaataaaaagtgtccacacatcctgtgtgtaccagaatgcaactgg
aacaccccccactgcccccttgtccagggtcttgcctttgcctggttccccaccagagtc
tcctcacccgcacccccaacccccatgcccatgcccattccccggactcccgccctgcag
GGATACTCCTTTGTGGCACCCTCCATTCTCTTTGACCACAACAACGCGGTGATGACCGAT
GGGCTGGAAGCGCCTGGTGCTGGAGACCGGCCAGGTCGGGCAGCGGTGGCCAGGAGCGCT
ATGATGCAG
gtgggctgggctgggctgggttggggggaaattggttttaggagaggcctaggcccgggg
actctaggcctagatccaactggcgcccgcagcgtgagctcagcaaggtcctaagcctct
ccgacatggggcgtggcggggccgcggggctaccaggtgggacctctgacgcgccgcctt

Exon 11 +      10498      10611   0   Internal    114    87        Good
gaaattggttttaggagaggcctaggcccggggactctaggcctagatccaactggcgcc
cgcagcgtgagctcagcaaggtcctaagcctctccgacatggggcgtggcggggccgcgg
ggctaccaggtgggacctctgacgcgccgccttcgccttcgccttcgccttcgcctccag
GACTCGCCCTTCTTCCAGCAGTACGAGCTGGACCTGCGGGAGCCTGCGCTGGGCCAGGGC
AGCTTTTCTGTGTGTCGCCGCTGCCGCCAGCGCCAGAGCGGCCAGGAGTTCGCA
gtcaagatcctcagtcgcaggtgggagggcccaggcgcgggcaggggtgggggtggcaga
gcgctgtcccgggggcggggccgaagcgcggcgaccgtaactccttctgctccgtccccc
aggctggaggcgaacacgcagcgcgaagtggctgccctgcgcctgtgccagtcacacccc

Exon 12 +      10734      10827   2   Internal     94    99   Excellent
gggcagcttttctgtgtgtcgccgctgccgccagcgccagagcggccaggagttcgcagt
caagatcctcagtcgcaggtgggagggcccaggcgcgggcaggggtgggggtggcagagc
gctgtcccgggggcggggccgaagcgcggcgaccgtaactccttctgctccgtcccccag
GCTGGAGGCGAACACGCAGCGCGAAGTGGCTGCCCTGCGCCTGTGCCAGTCACACCCCAA
CGTGGTGAATCTGCACGAGGTGCATCACGACCAG
gtgatggcttccggccaggggagggcggagagaaaaggggcaggcggcggggcttggggg
cactatgggcgggatctaggggtgaattgggcggggcctagcgtttgattcggggcccaa
agggaccagggaggcgcagggagtggaatttgaggggagtagggcctgaggacgggaagg

Exon 13 +      11476      11649   0   Internal    174    92   Excellent
gggcgacaaagcgagactgtctccaaaaaagtaacaaagaaagaaagaaagaaaaaggac
tttgaggagggggttctcgaacattggcagggcccgaaggccgggggcggggcctgggtg
gtgggagggggcttgccgccgtgggtgggtgttgaccttggcccgccacgccgcccgcag
CTGCACACGTACCTGGTCCTGGAGCTGCTGCGGGGCGGGGAGCTGCTGGAGCACATCCGC
AAGAAGCGGCACTTCAGCGAGTCGGAAGCAAGCCAGATCCTGCGCAGCCTCGTGTCGGCC
GTGAGCTTCATGCACGAGGAGGCGGGCGTGGTGCACCGCGACCTCAAGCCGGAG
gtgggcgagctgcctcggcggcggggcggagcggtggcgccgggggctgcctctgaccac
taccccgccgccctcgcagaacatcctgtacgccgacgacacgcccggggccccggtgaa
aatcatcgacttcgggttcgcgcggttgcggccgcagagtcccggggtgcccatgcagac

Exon 14 +      11729      11923   0   Internal    195    93   Excellent
tcagcgagtcggaagcaagccagatcctgcgcagcctcgtgtcggccgtgagcttcatgc
acgaggaggcgggcgtggtgcaccgcgacctcaagccggaggtgggcgagctgcctcggc
ggcggggcggagcggtggcgccgggggctgcctctgaccactaccccgccgccctcgcag
AACATCCTGTACGCCGACGACACGCCCGGGGCCCCGGTGAAAATCATCGACTTCGGGTTC
GCGCGGTTGCGGCCGCAGAGTCCCGGGGTGCCCATGCAGACGCCCTGCTTCACGCTGCAG
TACGCTGCCCCCGAGCTGCTGGCGCAGCAGGGCTACGACGAGTCCTGCGACCTCTGGAGC
CTGGGCGTCATTCTG
gtatgggacgcggtccttgaggcggggtcagggtcgctcggacctggcgtcttcctgatg
tgcagcagcacgagggaggggacaggggtcatcttggtgggggcggctgggtttcgtccg
aagctgggatcggggtggttcaaatacagaggtggggtcgctctggtgctagagtcggag

Exon 15 +      12255      12414   0   Internal    160    89        Good
gtggggtcgctctggtgctagagtcggagcatccgggtattgggggttagaagtcagggt
tcaccacgcgtgggtctcaggagtgcccctagtggggagggtgagtggttctgtgggagc
ggaggggtcagcctcggcaccccagcctgggccggcctcaccttcccctcaccctcctag
TACATGATGCTGTCGGGGCAGGTCCCCTTCCAGGGGGCCTCTGGCCAGGGCGGGCAGAGC
CAGGCGGCCGAGATCATGTGCAAAATCCGCGAGGGGCGCTTCTCCCTTGACGGGGAGGCC
TGGCAGGGTGTATCCGAGGAAGCCAAGGAGCTGGTCCGAG
gtgcggagctggaggtcatagaccatggttggggagggggacgctgggacagggatggtc
actgggccaggtgtcctggttggggatgggtaggggaggagagtggggctgttacgatct
ctttggggctcagcctttacgccaggctcctccccacacttccttgccccgcctccaggg

Exon 16 +      12593      12756   1   Internal    164   100   Excellent
aggtgcggagctggaggtcatagaccatggttggggagggggacgctgggacagggatgg
tcactgggccaggtgtcctggttggggatgggtaggggaggagagtggggctgttacgat
ctctttggggctcagcctttacgccaggctcctccccacacttccttgccccgcctccag
GGCTCCTGACCGTGGACCCCGCCAAGCGGCTGAAGCTCGAGGGACTGCGGGGCAGCTCGT
GGCTGCAGGACGGCAGCGCGCGCTCCTCGCCCCCGCTCCGGACGCCCGACGTGCTCGAGT
CCTCTGGGCCCGCAGTGCGCTCGGGTCTCAACGCCACCTTCATG
gtaaggggcagggtctgttgaagggaaggggtgggcgaagcctcgagaggtggggtctgg
ggaggcccggccatcggagcacagaaaggcgaggtgaggccgggcgcggtggctcacgcc
tgtaatcccagcgctttgggaggccgaggcgggcggatcacgaggtcaggggttcgagac

Exon 17 +      13313      13510   0   Terminal    198    84        Good
aaaaaaaaaaaaaaaaaaaaaaaagggaggtgaaccgaatccggtggtcggtctggaggc
caaggccctgtcggccttgacctaggcggctggaggcaaggtctgggaatggaggtcaaa
ctagatctggaagccggggtcaggcgggggtgggggcactcaccctttcctttctgccag
GCATTCAACCGGGGCAAGCGGGAGGGCTTCTTCCTGAAGAGCGTGGAGAATGCACCCCTG
GCCAAGCGGCGGAAGCAGAAGCTGCGGAGCGCCACCGCCTCCCGCCGGGGCTCCCCTGCA
CCAGCCAACCCGGGCCGAGCCCCCGTCGCCTCCAAAGGGGCCCCCCGCCGAGCCAACGGC
CCCCTGCCCCCCTCCTAA
tccccaccactgtgacccccttccctcataggggctgtgacctgggagcccggctcactc
ccggaggcctctgcctgcggctgacctgatccccaagggactgtcctttcctctcctacc
ccaccccactcccagacagagcagaagtatttttataagcagagaattttttatgtctta

--------------------------------------------------------------------------------