--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13101 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1280       1616   0    Initial    337    86        Good
cgtttctgattggtcgctggacgcgcgggatgcgagtccccattggctaggccagggcgc
ctgcgcggcggggttctcggtcgccagccattcctgaggaggactgccggtcgttcggac
gtcttgcctgtcgctggaggagaggtccgggctctccaggaaggtggctgcggcgacaaa
ATGAAGATATTCGTGGGCAACGTCGACGGGGCGGATACGACTCCGGAGGAGCTGGCAGCC
CTCTTTGCGCCCTACGGCACGGTCATGAGCTGCGCCGTCATGAAACAGTTCGCCTTCGTG
CACATGCGCGAGAACGCGGGCGCGCTGCGCGCCATCGAAGCCCTGCACGGCCACGAGCTG
CGGCCGGGGCGCGCGCTCGTGGTGGAGATGTCGCGCCCAAGGCCTCTTAATACTTGGAAG
ATTTTCGTGGGCAATGTGTCGGCTGCATGCACGAGCCAGGAACTGCGCAGCCTCTTCGAG
CGCCGCGGACGCGTCATCGAGTGTGACGTGGTGAAAG
gtaacgcggaggcgcgctcgggggcgggggcgcgctcggggcactctgcctgttagccac
gccccttacccgggggtcggtcactgcgcggttgggaggggtggggaagtgcgcgggagc
aggtcggaggtgttgggggcgcgttgggtagagccaccctcctcccctgcggtccaggaa

Exon  2 +       7594       7671   1   Internal     78    58    Marginal
agcatcctggtacttggatgctatctaagagtagccacaggtcgagaatggagctaagct
tagagccttatttcctaggggcaggattctctccttcagattctgcctgtgctttgtgag
tgtggacatgagaatttctttccattccttcattccctgaagttttctccttctgtgtag
TAGATAAGTATAGCTTTGAGACCGGCATCCTGTCTTCTCCTACCACAGCTTATTCAGGTC
ATAATGAGAGCTGCAGGG
gtaacctggttagcagagcctgttagctgcagtaattgcagcttcataccttataggtga
gaaaccagatctttctggtaagcagtctgctctgtgaacagaagcccaaggtgtaaggta
tacctctgtcccttaaagaggaaacagtggaggatgcagtgtggtctgggacagggggat

Exon  3 +       8773       9319   1   Internal    547    83        Good
gacagtcagaagctttgttatatgggagctacattttatgacatactcctggagaggagg
gtttggaggccttggaggtagctggcaacagctgggtgctgttgtgtgtccaatttggga
cccatcaggtagcatgccctgcccccctaattgctaaccctctgtctgctgctttatcag
ACTACGCGTTTGTTCACATGGAGAAGGAAGCAGATGCCAAAGCCGCAATCGCGCAGCTCA
ACGGCAAAGAAGTGAAGGGCAAGCGCATCAACGTGGAACTCTCCACCAAGGGTCAGAAGA
AGGGGCCTGGCCTGGCTGTCCAGTCTGGGGACAAGACCAAGAAACCAGGGGCTGGGGATA
CGGCCTTCCCTGGAACTGGTGGCTTCTCTGCCACCTTCGACTACCAGCAGGCTTTTGGCA
ACAGCACTGGTGGCTTTGATGGGCAAGCCCGTCAGCCCACACCACCCTTCTTTGGTCGCG
ACCGCAGCCCTCTGCGCCGTTCACCTCCCCGAGCCTCTTATGTGGCTCCTCTGACGGCCC
AGCCAGCTACCTACCGGGCCCAGCCGTCCGTGTCACTGGGAGCTGCCTACAGGGCCCAGC
CTTCTGCCTCTTTGGGTGTTGGCTATCGGACTCAGCCCATGACAGCCCAGGCAGCCTCTT
ACCGCGCTCAGCCCTCTGTCTCCCTTGGGGCACCATACAGGGGCCAGCTGGCTAGTCCTA
GCTCCCA
gtctgctgcagcttcttcactcggcccatatggtggagcccagccctcagcctcggccct
ttcctcctatgggggtcaggcagctgcagcttcttcgctcaactcctatggggctcaggg
ttcctcccttgcctcctatggtaaccagccatcctcttacggcgcccaggctgcctcttc

Exon  4 +      10029      10237   0   Internal    209    60    Marginal
aatagttacggggcccaagcatcaatgggcctttcaggctcctatggggctcagtcggct
gctgcggccactggctcctatggtgccgcagcagcctacggggcccaaccttctgccacc
ctggcagctccttaccgcactcagtcatcagcctcattggctgcttcctatgctgcccag
CAGCATCCCCAGGCTGCTGCCTCCTACCGCGGCCAGCCAGGCAATGCCTACGATGGGGCA
GGTCAGCCGTCTGCAGCCTACCTGTCCATGTCCCAGGGGGCCGTTGCCAACGCCAACAGC
ACCCCGCCGCCCTATGAGCGTACCCGCCTCTCCCCACCCCGGGCCAGCTACGACGATCCC
TACAAAAAGGCTGTCGCCATGTCGAAAAG
gtactgtatgcccccccgcctctgcccccagctggggcttagggcaaggggctgaggttg
gcatgggagggaaactggaggcatcggcccctccctcggtcttctcttctctatttttgt
gggatgtccagaggccgaggggagcagtgtctatgaactttcctggtcaccagggttcag

Exon  5 +      11020      11223   2   Internal    204   100   Excellent
gaagccaggcttgatttttttggcctggatagggtgatgagccttctgacaaaaggagac
caatctcttggagaccactgtgatcacaccctccctgtccccattggcatctccccaatg
cccacctggagtcctcccctcaattgtctcattcaccaactgtcttcttctctcgactag
GTATGGTTCCGACCGGCGTTTAGCCGAGCTCTCTGATTACCGCCGTTTATCAGAGTCGCA
GCTTTCGTTCCGCCGCTCGCCGACAAAGTCCTCGCTGGATTACCGTCGCCTGCCCGATGC
CCATTCCGATTACGCACGCTATTCGGGCTCCTATAATGATTACCTGCGGGCGGCTCAGAT
GCACTCTGGCTACCAGCGCCGCAT
gtagggccatcctgggatggggcaccacagggagggagggagaaaagaggtgggtagggt
tacagatccaggttataactactctggcccatacctttcctggttgtggtttttcatgcc
ctctaccatgtgggccttccccaggagatgatcctgttaagtgttcggcagtaacctact

Exon  6 +      12713      12810   1   Terminal     98    49    Marginal
tgccattatagtcaccggagactcctttacctatccctatctgttagggttttcagatgt
cctctcgctgggtttatatttgaaggtatagaatctgggaaagggtggggtgcaagctaa
ccaaatagggatgctagggttgggtggggaattgaggactcttctgtgcttttattgtag
GGCTGGGGATCGAGGATCTGGGCAAAAAATATGACATTTCCAACCAGGGACAAAATGGAG
GCTTGGGCTTAGTGATGGGTAAATGGAAGACTGGTTGA
gtgggatgataatgggagaacttactgatgctcttttgggaaaaggtgctttaaagactc
gatttgggagcctactggggcaaggcgactggggaggtgtacgtgttagtcaagtggagg
tcaggtgggttatcttctgcctccttcactggcttcatgtgaacttgcctgtgacagaat

--------------------------------------------------------------------------------