--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (87558 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1618       1687   0    Initial     70    96   Excellent
ggcggctgccagtctgtggagagtcctgctgccctccagccgggctcctccaccgggcct
tgcaggggccgagagagctcggtgcccgcccttccgctcgcctttttcgtcagctggctg
gagcagcatcggtccgggaggtctctaggctgaggcggcggccgctcctctagttccaca
ATGTCCACGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTCAAGCTGGTGTTCCTGGGG
GAGCAAAGCG
gtgagtgcgtggctcccctactcctggcagctggccgcagcgtccccgcaccgcccccgg
tgcggcccttccgtccgcggaggctccctgcccgcctcgcgtccgcgctcgttgccaccg
cagcccttcccgatgtgccccccggtgccactggctcttcgccagtggccgagtttttac

Exon  2 +       2068       2205   1   Internal    138    86        Good
atcctcgactccccggctccgttccccgcagtccggccatctccggtcgatctgccctcc
ctccccagacctcaccccgcccagcctcttgtccatccctttcttcctccggtctcggtc
attgcccgtaccccggccccctttcttgagccccacccttattccttgctcttttcccag
TTCCTCAGCTCTGTGAGGCCCACTCAGGGAAGCCCCACTCCCGAGAGCGGGCCCTCTTCA
ACCTTGGCCAAGGAGGGTGGGATCTGGGCGTTGTTTTCCCCAGAGGCTTGGCCCTGCGAA
GTGCTGATGTCGTGGAAG
gtgggaaggggtggtagtagaaaaaattaaatgattttcacctgggtgggaaattagtct
gggccatagaggaaacatctgaattggagacgacttgagcatggggtggttgggggtgaa
aggggtagcgtcggcagtggagatttttgccccttaggttagatggggctgtggcttgtc

Exon  3 +      10208      10278   0   Internal     71    51    Marginal
tggcctcccaaagtgctgggattacaggtgggagtcaccacacccagccttctgtagcat
ctttttaattcccaatttttaccttttcttgtcattttgaagatgttaataagatacatg
acttttttcttcctgcatatttagtttttgtaaattgtttttcatctctgcttgttttag
TTTCTCTATTTCCTGTTTGATGTGGTCCTCAAAAAACTAGTGTTTCTTGGCTATTTGCTT
CTATTTAAGAG
gtgagcactgagagttgtgtttttgtttttgttttttatgctcttgtgtgggtttgtggg
tctttactgcagaatgatcttgctgagttcctttttgggagtctctgatgttaggtcttt
aagtctttttgctggtcagattccctgaagaagaattactcagtgcactgctggagagaa

Exon  4 +      10418      10482   2   Internal     65    84        Good
aaaaaactagtgtttcttggctatttgcttctatttaagaggtgagcactgagagttgtg
tttttgtttttgttttttatgctcttgtgtgggtttgtgggtctttactgcagaatgatc
ttgctgagttcctttttgggagtctctgatgttaggtctttaagtctttttgctggtcag
ATTCCCTGAAGAAGAATTACTCAGTGCACTGCTGGAGAGAATCTTGGTTGTCAGTGTTCT
TGGAG
gtgaatggagagagggtttgaagtcataacatacagtaaatgcatttagtctccttgctt
ttaatattgtttgtactctatccctcagctgtaccttgtaatccctagtacagaaacccc
gtttttctttctcagcagcattatcttctaattttcagctgtgttgaacagaagagggaa

Exon  5 +      20732      20799   1   Internal     68    61    Marginal
ctatgatttgatagcttatttctttttggtgctgaataatactcaattgtgtggatatac
cacagtttgtgtatccattcacctactgaaggacattttggttgctttcaagttttgcca
gttactaataaaaagcagctgtaaacatacatgtacgtcctttttttttttcttgtgcag
ATTTTTGTGTGGACATGTTTTCAGCTCTTTTGGGTAAATACCAAGGAGCATGGTCGCTGG
ATCATATG
gtaagagtatattttgggccaggcacggtggctcacgcctataatcttagcactttggga
ggccgaggtgggtggatcaccttaggtcaggagttcaagaccagcctggccaacatggtg
aaaccccgtctctactaaaaatacaaaaaattagccaggcgtggtggcatgcacctgtaa

Exon  6 +      41354      41407   0   Internal     54    67    Marginal
tgaatacatgaaaatcattatcactggaaattttgtttgtccttaattgtccttaattga
ctatgttgtattgatttgtttattcattatttcttccacaatcatgaatcccatttgaat
cctaaactgctggccaccattaaacttattatttgttaacttctttgttttgttttacag
GCAACAATTGGCATTGACTTTTTATCAAAAACTATGTACTTGGAGGATCGAACA
gtgagtaatattttcagtgtgcaattttctgcaacattccaggttagaaaactgcaatca
aagttatcaatgattgtcaccataagaagtacttagcaaagttaccaaagatagtttaca
gttgttgagaaaaactcttattaccgagtgagtagtacttggcagtcatcttgatttgga

Exon  7 +      43363      43468   0   Internal    106   100   Excellent
ttctcccttttgaaaaaggagttttgtgttattttcattcctcactccctgcaacctctt
gcatgagtcttctttctacttccttcccaccctctcccttttacaaaaaacattgtttct
tttttctttttagtattagtttggtttttttttttttatttattttttcccatctcacag
ATCAGGCTTCAGCTGTGGGATACTGCGGGTCAGGAACGTTTCCGTAGCCTCATTCCCAGT
TACATCCGTGATTCTGCTGCAGCTGTAGTAGTTTACGATATCACAA
gtaggtatattgcaacgggttgacctttcttatttttcttgcttgtttgactgattttgt
tgttaggtacgattgcaattatgggacacagcaggtcaagagcggttcaggagcttgatt
cctagctacattcgtgactccactgtggcagttgttgtttatgatatcacaagtgagtgg

Exon  8 +      43535      43640   0   Internal    106   100   Excellent
tctcacagatcaggcttcagctgtgggatactgcgggtcaggaacgtttccgtagcctca
ttcccagttacatccgtgattctgctgcagctgtagtagtttacgatatcacaagtaggt
atattgcaacgggttgacctttcttatttttcttgcttgtttgactgattttgttgttag
GTACGATTGCAATTATGGGACACAGCAGGTCAAGAGCGGTTCAGGAGCTTGATTCCTAGC
TACATTCGTGACTCCACTGTGGCAGTTGTTGTTTATGATATCACAA
gtgagtggagggaattatgcatttctaatcttctttcaacctttagcttagctgcatgca
tgttcttgtcttgtgcttgttttccttactggcatgtaaaaataagttttatcatagtaa
attacataccagccaggtcagaaatatttgctttggtgtttataccaatatgctttatat

Exon  9 +      45891      46002   1   Internal    112    72        Good
gtttaaattgctgacagttgtaatcagataaaatggagttatgttgcaggcacattaaaa
gtggggtactaatgtgccagcccccttccaacttccagggcttttttggagggaggtgcc
caccacctggggaggcatttttcagcaacactaatctctctgtctaccctcctatactag
ATGTTAACTCATTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAA
GTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAG
gtatggagttattttatatgtgtgtaatgtttgatttctgtgatgcagccttttattttt
gttcactgagaaattgttttgaaaggagacatgcttaatccttaagtttacgtcctcccc
tgcttttctttagcatgggaacctcaaatataaatgtaaatattaaacagccagtcctta

Exon 10 +      50955      51137   0     Single    183    65    Marginal
atccttttaaaggagtactagacaggtacaaaaaggaatgaagaatgtatatattactat
ggagtgaatcttcagggtatatgactaagtgaaaaaatgcaaggtgaagtagtatgtaac
atatggtacagtttacttaagagagaaatacagatgtatatacacattacctaaagcaaa
ATGAGGACCCTACTGGGCTGCCATCCCAGCTGGACTGCTGCTGTGGAGCTCAGCATCAAG
TACTTCCAGGAGAAGCTTCAGCAGGACCTAGAGGCAGAGCATGGTAGAGGTAGAGGATAC
AGCCCTCATACCACCGTGCTGTATGTCCATCTTTCAAGTCCTGGTGGTGCCCGCAGAGTT
TGA
agggaagccactgcttcagagataccaggtggtaaatgcatgcctagtggaagtgtgctc
ctctgcatctatgcctttgagcagaaagcctttgagtcccaattagtgggcccatgagtg
gccaaaatgagggactgggacctgtatagccgttaaactataaatcagggccaaaaagga

Exon 11 +      54740      54833   2   Internal     94   100   Excellent
agtatacacacacagaaacacacaaatttcaagagtgtggcagattaatgaatttttaaa
ctaatgtgacctgtataaccagtccttatatcaaggaaagttattttcagagctttcttt
ataatctttataatactgcctcatgtctcaaaagtaagaagtttgtttgtttctttacag
GCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGA
AACTAGTGCAAAAGCTGGATACAATGTAAAGCAG
gtaagttgagttgaggttaccaaattgaaaaaatatgaaataattgtgtgagtattctat
tctctggtgtataggtttccttccacctggcaagagcaggccttacaaactagcagtata
ttttcaaacagtgaaaaatataaatgtggcatagtttttggaaaaagagaaaagacttgc

Exon 12 +      85356      85486   1   Terminal    131    93   Excellent
acggtaagaaaatgaagttctaatgaactgtttctcccaaggttttaaaattgtcaagag
ttattctgtttgtttaaaaaataagaaacctctttaagcaatagattttgcttgggtttt
cttttttaaaaacataatactgtgcaggcaaggcactgtaaaagttttaattccttccag
AAGAACCAGTGGAAGAATTTAAATTTGGCGCTACGATCAAAACTACTGAATTAGTAGAAA
TAATGATGTCTAAAGCTTACCAACAAAAGAACCCTCAGCAGAATAACAAAAACTTTGCTC
AGGACATTTGA
ggtcaaattgaagacggaaaccggaaaccgttttcttgtaagcccctagaggcagatcag
gtaaagcatacatagtagagggaaaggagagaatggaaataaaactcaatattatgcaga
tttatgccttattttttagcattttttaaggttgggtctttcaggctggttttggtttgt

Exon 13 +      86698      86731   0    Initial     34    70        Good
tcttcaaagcattgaagtgtgttcatagtccaggttttttttttaataaacacaattttg
ctgccaaaaatatataaataaaacacgaaagaaaacaattattgacctggtttcccattc
ctgccaagatggtgaattagcatttacttctccctctctgggaagacctttaaagcagac
ATGGACAGAATCCAGAAAAATAACAACAACAAAT
gtgaggaactcctagggagtcaaagactctttttttgatgggggtattgttggggggtgg
gggagaggggctgcaacttgaaagatacatcccctggtggaggcagtaataggacatatt
aagaaaagcatcttaagttctgcttttgcgtcctcactcctaactatacctttgccttgg

--------------------------------------------------------------------------------