--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (23681 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1436       1590   1   Internal    155    79        Good
gccggcacacacacattaacacacttgagccatcaccaatcagcataggtgtgctggctg
cagccacttccctcacccacactctttatctctcactctccagccgctgacagcccattt
tattgtcaatctctgtctccttcccaggaatctgagaattgctctcacacaccaacccag
CAACATCCGTGGAGAAAACTCTCACCAGCAACTCCTTTAAAACACCGTCATTTCAAACCA
TTGTGGTCTTCAAGCAACAACAGCAGCACAAAAAACCCCAACCAAACAAAACTCTTGACA
GAAGCTGTGACAACCAGAAAGGATGCCTCATAAAG
gtgagtccgcttctttcttctcgctttatttttattgcaatattcagacaggtctccccc
ttcctccccccttccttcctcccctctcgccggtcccctcccccactgctacgccgggag
agttgggccggagaagtttccacgcaggagcccaaactttctacttccagcgaaagcccg

Exon  2 +       9584       9714   1   Internal    131    76        Good
cagggggatgaggatgcattgtggttgtctcctcctcctctccttcttcctcttcccctt
cctcctctcctttctgttcttgttctccctcatcttcctcttccttcttctccctcttct
tcctcttcactctgctctcttctcttcttttcccctttcctctcctctccctttcctcag
GTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACT
CCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCC
GAATTCTGCAG
gtgatcctcccggcgccgccccactcgccgcccccgcggccctccactctcaacgccctc
tcttcatttcttactgtaaacgatgctaattatggacccccccaccctcacccaccccag
tccccagtccccccacccactcccctgccttcccactttcccctctccttccaccatcct

Exon  3 +      10642      10857   0   Internal    216    87        Good
acagtaagttctcataccattgaaggtatatttttgtgttatagacccatgcagatgcaa
aagtccaagtgctggacaatcaaaacgtaagcttgtcattgtttaatgcatacttaaaca
attttatttttgtcttgaaattattaataatgtggttttctgtccacttcccctatgcag
GTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA
CCCAGGGCAATCGGTGGTAGTAAACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATA
GCCCAGTATAAGCGGGAGTGCCCGTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTG
TCCGAGGGGGTCTGTACCAACGATAACATACCAAGC
gtaagttcattgagaacatctgccctccctgccctaagcccaatgctctctcctctttac
ctcctcccaccctctctctccactgtctcttagtctgtgtcctctccctgctccacattt
gtctcctttgtacctgggggaacagagaggaatgccctgacttttctttgactgtctgga

Exon  4 +      11562      11883   0   Internal    322    53    Marginal
cccaaagtgatagctatcattttttccacggtgtatctgcaaatccacccactgtcccgg
ggtggctgggagctttttaacgggttgagagttgctttttaaggttgtgggtgagctgag
atgggtgactgtgtcttcaggagacactaccatttggtttgattttggtttgatttgcag
GTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCA
GACGGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACCCGC
CCTGGTTGGTATCCGGGGACTTCGGTGCCAGGGCAACCTACGCAAGGTAAAACCCAAGCA
GCCATCCACGCAGCTCTCCATATGTGCATCCCTTTGCCTGTCCCCTACTCTCCCAACCAT
TTCCTCTCAGGGCTTCCATGCTTGGGGAATGTCATGGGTGAGACTGCATTTGAAGGCCTG
GGACACATCGACCACATTGTAT
gtaggtggtgtttgttgaaccattttgttggcctgggaatgtgagggttgtgtatgtcag
gagcggtatgaaggtggctggtgggtgcgtgtgtgtgtttgtgggcagcactgtgtgcat
aagaacgagctgcgtggtgcactattcaaatttgacattagaatgcagggagagccccct

Exon  5 +      12364      12461   0    Initial     98    40        Poor
agcagggagatgcagggcgagtcggggatggggcattggaagtggtggtctcccaactaa
aaccaccccactatccttgcccctcccccgttcgcccctctgggtcccactttctcactc
tctgtgggtggcgactatgtggaagtggtgaggtgaagatactgtgagcaggacggcggg
ATGCCGGGAGCCGCTCTGGTCTGGGAGGAGAGATGGGACCTGAAACACCCCAGGTTCTGT
GAGAAGGGCTGGAGGAAGAAGAGCGGGGGATGGGGGGG
gtggggcggaggggagggtcagttggctcccctccgctcccctccacaccccgaggtagc
ttggtcaagaataggaaacagtttactccgaagattaatcggtatttgttgtcctcgtga
caaggagataatatgcgggataatgggacgtggcgtctcactcccaggagcacaacggag

Exon  6 +      17630      17806   1   Internal    177    97   Excellent
tggtcaggtaactaacatcgcaaatgtatttttttaaaagaaggctgacagttaccttgg
gaatgttttggtgaggctgtcgggatataatgctcttggagtttaagactacaccaggcc
ccttttggaggctccaagttaatccaaatttctcttaccatcctattctttttgttccag
ATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAATACCAACTCCATCAGTTCCAACGGAG
AAGATTCAGATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAA
CATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGGTGATAGAGTTTTTCAAA
gtagagaagcagtaaatcaaagtaaatgccacatcttcagtacaaagagctaaatttagc
cagggccctttgcatagaagaatgaaaagatttccttttttctgtctttttatttctctg
ggcatcttttcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgt

Exon  7 +      18865      18980   1   Internal    116    93   Excellent
agcaacacacctagtcatattcctatcagcagtagtttcagcaccagtgtctaccaacca
attccacaacccaccacaccgggtaatttgaaatactaatactacgaatcaatgtcttta
aacctgtttgctccgggctctgactctcactctgactactgtcatttctcttgccctcag
TTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCT
ACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATAACCTGCCTATGCAA
gtaagtgcggctggtggtggcctgcataacccaggccccagagaagtgaggagtggctca
gggcctgcggacctcattggctgtgtctgcacccttgagagcttttcgcactacagtgat
tggcttgaccagtcaagtcggagacagtcaatcccatcacttttaagtgattgactcatt

Exon  8 +      21558      21708   0   Internal    151    76        Good
ccagtggaaggactagctcgaggcccaatcttagatttatcatatggaattccagtactt
cacgtgaaggcatctttaatgatcagacttgttggcagagttcctcgggaggagggagcc
tggggctgtggctgtgtgatgtgttcctcagtaaccacaggtttgcctctctcctcacag
CCCCCAGTCCCCAGCCAGACCTCCTCATACTCCTGCATGCTGCCCACCAGCCCTTCGGTG
AATGGGCGGAGTTATGATACCTACACCCCCCCACATATGCAGACACACATGAACAGTCAG
CCAATGGGCACCTCGGGCACCACTTCAACAG
gtgagccactgctttctgcaggctgcacagaggcgatctctcttcactagaagtttaccc
aaacagaatctcctggtcttatgggagggcgtgtttaactccttgctttccttgtccctg
ggggatggggattgaaaagggaaattcagttaagctaattagtaactttacaccatatag

Exon  9 +      22847      22927   0   Terminal     81    51    Marginal
atacagaaggcacgatatcagttggaacaaatcttcattttggtatccaaacttttattc
attttggtgtattatttgtaaatgggcatttgtatgttataatgaaaaaaagaacaatgt
agactggatggatgtttgatctgtgttggtcatgaagttgttttttttttttttaaaaag
AAAACCATGATCAACAAGCTTTGCCACGAATTTAAGAGTTTTATCAAGATATATCGAATA
CTTCTACCCATCTGTTCATAG
tttatggactgatgttccaagtttgtatcattcctttgcatataattaaacctggaacaa
catgcactagatttatgtcagaaatatctgttggttttccaaaggttgttaacagatgaa
gtttatgtgcaaaaaagggtaagatataaattcaaggaagaaaaaaagttgatagctaaa

--------------------------------------------------------------------------------