--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (155645 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (34 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1293       1458   0    Initial    166    60    Marginal
gcgagggagggagcgagggagggagcgagggaagggaaaggcgagcgtgagctgcctcaa
atgcttggaataattccgcttccgtttggaaagccgcagcctcagtcccgccgccgcccg
ctgcgtccgcccagcgccagctccgcgtcccgaccggcccgcggcagcctgcgccgcgcc
ATGGCCACCTCCCCGCAGAAGTCGCCTTCTGTCCCCAAGTCTCCCACTCCCAAGTCGCCC
CCGTCCCGCAAGAAAGATGATTCCTTCTTGGGGAAACTCGGAGGGACCCTGGCCCGGAGG
AAGAAAGCCAAGGAGGGTGAGTGCGGCCAGGCCGGCCGGGCGGGCG
gtaggagccgggggtgccgtaggggccgaggggccggggcactgggaccgggcgggagcg
cgccgcgggtgcccggcgcggtggggcgcgcggcgatgcgtgcgcgcgcttcccgggtac
gtcgggcaggagcgacgcgcaccccacactgagcccggggctcgcgggccatcgaggcca

Exon  2 +       2283       2340   0   Internal     58    78        Good
agaaaacctgcgtgagacacaaacttcgtcatgggcctgctgtgaactcaggcattcagg
gctttcgtaaaaacctttgttttttccccaccagagtgaattgaggcgaccttattcttt
tttttttttttttttttcagggtagtttgcatgtaaaatatttttttttcccatgcacag
ATTTTGCGTCCTGGTTTTTGGTTTGAAAACGAGGTGGCAGTTCTCAAGAAGCACTGTG
gtgactggtgtgtagatagaagttgctgagttaaacatttttgttttaaacattttttag
ttgatgcatgatgtacatagttctggggcacatgtgataatgtaatacattcatataatt
tgtaaagatcaaattgcacaggaaaggggtcccagtccagaccccaagagagggttcttg

Exon  3 +       4675       4810   0    Initial    136    66    Marginal
tatcagcttactcaaagacatttttatatttgttgctcctaaatcacagccttccctatc
ttggatttactcagttgggtttttgaaaccaagtgtaagatcttattttcatccctgtta
tatttcactgtaaagtcctgattccttcattcagtctgtcaactaatccaggggctgtaa
ATGGATGAATGGAAGAACACAGAACGTCTTCTGAAGGGCCAGCCACCACCCAGCTCCAGC
TGCTTGCTGCGGCATATGGTATTTCTGCAAGCCCAGGCAAAGAAGGCAGTGGGTTGGTTT
GAAATGACTGTCCTTA
gtgagtatgtgctggatctcaatgatcagtgctgaagtgatggttagtaggtgtggggcc
ccattaaccatcacttcagtaataataaggccggatcttgctctgcatcctggataagct
cacagctttgtgctctgtagaatctgccttcttcaactttctctttggtgttcttgaacc

Exon  4 +      14710      14808   0    Initial     99    42    Marginal
acaattccattttaaagcagctctcaggatacaggcaagtcctgaaatagccccatgtaa
ggagtagcagctgcctcttggctgagtgttacaaggcctctcttggtgggctcagcagct
ccttcagcacatgcccaagttcccagagaacagaatgatccctttgcctgcatttcctcc
ATGGCCATCATTACAGTAAATTGCAAGGCTCTCATGATGACTATAGAGAGGCAGATTGAT
TTGTTCCTTCTGATTGTCACTGTGCTGAACGTGGCCGGA
gtgatgggcacccagatttcacaccttgtaatggccctgccagggtggatgttagcacaa
ttgggacctgacgcttcaataaatctgagacattctgctgtggagatcaaagttcggaat
tgcttaaattggtgttggagcaggtgggaaacaggagtccagggccatgaattggctaga

Exon  5 +      17884      18028   0   Internal    145    70        Good
gcatttcacacttactattttattgaatttttacaaaaccctatgggatagggaattatt
attattttcatttttcagatgaggaagctgaagcagagagcttggttccacgtccaaggc
catattattagtaagaggtatcactgggcttggaatgcccccacacaactactgtgctag
GAAGGGATTGAAGGGAAGAAGAAAGAAGATGAGAGATCCAAAGCCACCAGAGACACAATT
CAAAGTCAAAACCCAGCTAGTTGTTTTGAATCCTGCTTCAAACAAATCAACTTCTACAAG
TCACTTATGAGACTATCAAGAAAAT
gtaaacactcatgggagatctgatgatattaaggaatcattgttagcttactgggtgtga
gaatgatgttttggttatcttaccaaaaatgtccttatcttttcaaggtacatactgaaa
tgtttgtggatgacacaatgaaatgtctaggatttgcatcaaataatgcagtgtaggggt

Exon  6 +      18328      18478   0    Initial    151    51    Marginal
atgtttgtggatgacacaatgaaatgtctaggatttgcatcaaataatgcagtgtagggg
tcaaggtaaagatggaatcaagagtaggcacaagttgttccttgttgtagaatggtggtg
ggtatgtggagagttgctgtagtattctgtctactctgggtatatctgaaattttccatt
ATGATTACAATCATCCTCCTGTATACACAAGAGATTGGTCCCAGGACCCCTGTGTATACC
CAGATCCGAGCACACTCAAGTCCTGCAGTCAGCTCTACGGAATCCACCTATATGAAAAGG
CCCTACAGGCTGGGCGTGGTGGCTCAAGCCT
gtaattccagcacttggggaggccgaggtgggcagatcacctgtggtcacgaattctaga
ccagcctgaccaacatggtgaaaccccatctctactaaaaatacaaaattacctgggcgt
ggtggctcatgcctttaatcccagctacttgggaggtggaggcaggagaatcgcttgaac

Exon  7 +      32398      32697   0    Initial    300    50    Marginal
tttgttggaatcccagctaactagttctgggaagttggccatatcacttagtttttttca
tttatccagttcagaactgctcacttaacaaatatttcttaagaccctactatttactaa
gccctatgttaggggttggaggatatagcagtgaatagggtagactaggtttctgacccc
ATGGACCAGACAGGCAATATAAAACAAATAATGATAATTTTAGATAATAGTGGCTTGGTG
GGAAGCGGGGTGGTCACTTCAGAGCAGATGGCTAAGGAAGGCCTCCCTGAGGACAGATAT
TTCAGTGGGGATTGGAATAGTGAAGTGGGACTAACTATGATCTTGGGAATGAATGTTCCA
GAAAGAGGGGTCAGTAGGTACAGCCACGAGAGTTCAAGGAACCAAAAGGAGGCCCCCATG
GCTGAAGCACGGAGGACCTGGGAGAGGCCGAGGGGGATGGTGCTAGATGTTGGGCCAAAG

gtaggtcccacagggccttgcagggccactggaagcctatgaattttcctaaggacatat
ggaaagtcattagaggattttagcaagtgagtgaccagttctggtttcttaacagtgcct
gcttcattaaacatcaaatacaattaagtaaggttatatatatataatatgtagtggtgt

Exon  8 +      40196      40374   1   Terminal    179    57    Marginal
tggtggaaatgctgtgtgacatgaatcttgccaaaaactaatggatcatttacaggaaat
aagaagttgaagagaaggatgagttagtagacttcaaagcaaactcatttccacagaacc
taaataatgaataccaaaacctgaagatttcacagacagcttatatggctctctgtacag
CTGGAACCTTCGCCGACTCCAGCGCCATCTGCCCTGATGAAGGGTCCCTGCTGCTTCAGG
AAGGAAGGAAGAAAAGGAAAGAAGGAAGGAAATCAGGGGAGAAAGAGAAAGAAGCGAGTG
GAGAGAAAGAAGGAGAACAATTTTACAAAGAAAGGGAGAGGAGGAGAGAGGAAAGATAG
ggaggaggcagagaaggaaggaagaaagcaatggagggagaaagaagggaagaggaggga
gggagggagaaaggaggggagggcacgagggcagagagatggaaggtgagagcatgaggg
ctgatcacaaggtgggtcgttaagtctaattttgcacaaatgggttttgtatggccagta

Exon  9 +      43310      43545   0    Initial    236    81        Good
tgtgtataccacattttgtttatccattcatccattgtcggacacttgagttgcttccat
cttttgactattgtgagtaatgctgctctggacatgggtgtacaactatatcttcaagac
tgttttcaattcttttgagtgtatgcagaagttaaattgctggatcttacaggtaattct
ATGTTTAATTTTTTGAGGAACGGCCATACTGTTTTCCACAGTAGCTGCACCATTTTACAT
TCCACAGCAGGGCACAAGGGTTCCAGTTTCCCAACATCCTCACCAATACTTATTGTTATT
TTTGTTATTAATAGTAACCATCCTAATGGATATGAAGCAGAGTCTAGCCCTACCGTGGTT
AATGTCAAACTGAATTCTTCTTACGTTGTTGCTGAAGGTGTGGTGGCAAAACCTAG
gtaaatgctggcggaaacacttttaagattcatatatactgctgttcagaatgtctccca
tcattatgaggaaaatatattatttttagcagatgttaaatcaactatattaattataag
ttctgttcagtaatgttccgaatacatacgtagctagttctcaaaatgcattccttgaag

Exon 10 +      44690      44797   2   Internal    108    89        Good
gtccaggcggtagagtccagagcctgtcctcttcacaccaccccacccagcgagaatgga
aggagttagctgccagaggtcttaaattcctggatccttcaatgatcactcaaacggtgg
tcaaccatctgtttatatcagcatgttaggactttttttttttttgtacttctcaatcag
TACCGGCTCTAAAGGTGATACTACCATGATTTACTACTTGGGGTGTCTTGGTGGTCGGAG
CTTGCCATTATGGATTGCTAGGCATGAGATGGACAAGGTGGTGGGCTG
gtaagaggggcaactaaggatctgacccagctacaaaaagttgcacagatgaggctatcc
aagcatggtacccaagagggattagaaatatctctgcccaaaactgaagtgtttacatta
tatacttaggaagtccaagtaaagacatgagactagactttaggttgtggggctctggtg

Exon 11 +      58982      59082   1   Terminal    101    87        Good
ctctctcttcagctgcctgcttcttgaagctctcctcttcctcagctgtgacaggtgttg
ctcaaggctcccccctctctctgatcacttgttccattttccccactgactctccctttt
cttcttaaaaattattcctcccttagttcccatccttttccccttctcctgtcactccag
CCAAGATCCTGATTCCAGAACATGGGGAAAAGTACAGAGGGTTGACCATTCCAAAGCTGC
TTCTGAAAATATCCCTGTCATTCAACACAGATGAGATGTGA
aacacacagatgggtgacagagcttccggtctatttctaagtcccaggaccgaagagttc
ttgtttttgtcatgatagcaagtgcttgtgtttgatgctccaaatagccaaacccgtgga
attacaggggggtttgagctgcatgttgagtgtacaaactctcataggtcataaggaatg

Exon 12 +      66062      66184   0     Single    123    42    Marginal
cagctgaacaaacttcttacctcttttgagcctcagcatcaaatggagatcacaatacct
acttagcaggattgctatagagttaaataagatgcatatgtaagctttgggaagcattaa
gcaaatgtaaggtatggtattcatactattaacaggaagaaagtgagactctaacttagg
ATGGTGGATGGCCAGTGCCTGAAGAAAAGGTATGTGGAGCCCAAGACAGGTATTGAGAGT
GCAGCAAAAGACTGCATTTTCAAGGTCAATAGCTGTGACACTAGGAGCTTGAGGCTGCTT
TAA
agagggagatgtggaggagatgtagggcagaagtctcaggtacaagacaaaaagccctca
ttgcttggctgtccacaggtacattgactaagctcttaggggtgcagcctaagagcagag
cccctatgatctattcaccaggcccactgagaatccaggcaccatgagaaccgaggggaa

Exon 13 +      71937      72124   0    Initial    188    41    Marginal
ggctgacatctgattaacctaccttacagtagagataaccaaaactcagagattttggtc
gtgttgcagcatggccagttacctacaatggaatgaggaaggcggggggtcatagagatc
tgacccttctgccaggctaggattgcactaggattgctggcctgcacgctaatggggaag
ATGCAGCCTGGCCAGCATGGGTGCAGCCGTGATCCTTCTGAGATTCAACAGCAACACAGA
AGGATCCAAGACAAAGTAGTAGGATGTTTCCAAGGGCAGATGAGTGCGGCAGCAGTTGGA
TGGGATGATGCTCAGATGTCCAGAAAGGCAGGCTTAGGACACCCAGGAGTTGTAGCTCCA
GACATTGG
gtaagggtgcttggcaattctctgggatgaggtgctcagcagattcttggacagggattc
atcaacagggaccaaggcagaacttcagttataagaacgtgagtaatggattagaactgt
cgtttattggaatgaagcagtgccctgggatcagacagtgatgctgttgagcccgagtca

Exon 14 +      77668      77838   2   Internal    171    79        Good
ttcagccacagtggagcccaagggatggccatggtgagcgagccctcttggttcccctga
agacgtattgtgggggacacagcatctccctggggtcctttgtgctgtcatcacagatta
gcagccccttcctaacggatgaatgtataaaccacaaatccactcctttgccccttccag
GAAGGCATTTGTATTGAAGGTCACAGCCAGAGAAGACAGTAACTTGGGGGGAAAACAGGA
GACTTTGAGGGATCCAGAGGTCACAAGCAACCCCTGGAGGCTCCTCAGCAGAGCTGGTGT
TTGCCCTTGGATCCAGGAAGTGGGCGGAGCAGATATGAAGGGAAGAAGGTG
gtgagaggaccctgggctgctactcatagaaaagagccctttcactgtttcacctacatt
tcagtggagaccagtgaagatggatattttctccaatattgactaaatagtataattttt
ttctttacacaaattgccacttaatgtaatttgttgactttccttaggggctttgataga

Exon 15 +      84097      84225   0     Single    129    58    Marginal
agctggctcaggatcaaaccttggctccactttctagctgtgtggccttgttcagattat
ataacctctctgggcctcattttcctcatctgtaaaatgaggataataatagtacctact
cattggattgttgcaaagattatatgagttaatacatgtaaaaaaccaagtgttatatcg
ATGCACCTGATACAAGGGACATACAATGTGTGTGCCCTCACCATCATCATCATCGATGAC
AGGAGAGAGTTTCCACAAACAGTGCTCTTCAGGGTAAACCACCGACTCTTCAGACAAACC
CAGAATTAA
ctcaccagcaaatcgatccaaccagaacacagcatgtctgtttgcttactagccccactg
agagctgtttccaaggttacctcttaggaattcagtggactagtagttgatgtggcactt
tttaagcagcactgagccactgcaaaaataaatgactggctgttcaggattcataaataa

Exon 16 +      94602      94699   0    Initial     98    70        Good
atgggaagtcacaagaaagcttgaagtgggagaatgtatgatcctatttacatttttgta
gaacattctcgctgcactgtgggaagtaggtgagagtgggggaaatgcaagcaaagcagt
agaccagttagaaggtggttctgataggccaggcaaaagataacggtggctcaagtcagg
ATGATAGAGCAGGGAGATGGTGAGAAGTGTTTGGAATTGGGTCCTGGTTTGGAGGCGGAG
CCCACAATACTTGCCAGTGTTTTGGACAGATGCAAAAG
gtgaggaaaatgagaacttaagagtgattcctcggagcttggcgtgaaccatggtgtaaa
cagtggtgccatctactgaagaggataagaataaagaacaggttcattttagtgctggta
tggtgggtatgagggtgttgagaatcacaagttctgtttggatgtgtacatttgagatct

Exon 17 +      95262      95382   0    Initial    121    43    Marginal
ggggcttgttgtatggattattttcccatcaactatagactggataaagaaaatgtggta
catatacaccatggaacactatgcagccatgaataaagaaaggatcatgtaatttgcagc
gacgtggatggagctggaggccattatccttagcaaactaacaggagcagaaaaccaaat
ATGGCATGTCCTCACTTAAATCATGAGAACATACTTGATGATCTTGTGATGGAACCTTTC
TACATCCATGCTGTCTGGTGTTGTAGGTACCAGCCACCTGTGGCCATTGAGTACTTGAAA
T
gtggttggtgcagctacggagcggaatttttaattcactgaaatttaaatagctcaagtg
gctagtagctactgtattggacagtgccgatcagtgtagctacaggagagaaagtcccag
gcaggagcaagttccttcattggccagtaagcctagccttgcagccacatttaaacatga

Exon 18 +      96027      96130   0    Initial    104    84        Good
acactaatgatagctgatgagctattaaaaatctccagataatgtcataatgttttaaga
aagtttatgaatttgtgttgggctgcattcaaagccatcctggaccacattgcagcccgt
gagctgtgggttggacaagcttgatttaagctttgaaggtaccccttctgtgtttctgtc
ATGTTTTATGGAGAATTCTATGAAATAGTCGGTGTCTGTGAATGTGGAGATCAAGGTGGT
GACTGGCTGGTACCCTATGTGAATGTCAAAGACCTGCTGCAAAG
gtactaaataccagcctcgccatgcaagttgtgtctcttagggcgtagagagtgtttcac
tccctttgtttctcagtctccttccagtccaactgcagctatcagtgagtgtattgaggt
gaaagaactctttgtaagtggctgccttgtgcttaggatttcttgcaagtctatgctggc

Exon 19 +      97390      97511   1   Terminal    122    93   Excellent
gggacaattaggtcctttcagccaggcgaggccatgaattgatcgtaggctgagtaacag
ctgtaatctacccttagtgggtttttttctcaatgtcaatatcgaacacccttgttacag
agctccaaccccctgccgtccgtcagctgaaatgtgaccctgctcttccttttcttccag
TGTCCGAGCTGCAGGAGGAGGGAATGAACGCCATCAACCTGCCCCTCAGCCCAATTCCCT
TTGAGCTGGACCCCGAGGACACGATGCTGGGTAACTGTGCTCTTGTCTCTGAATTCGCTT
AA
gctttcccatgccagcacccccactgaattccttttctttttaaagaggagaatgaggtg
cgaacaatggtggatccaaactcacgcagtgaccccaagcttcaagaactgatgaaggta
agaagaaatcaggagcggcttcaggtgcctcactgacccaccatgtgtccatatgccacc

Exon 20 +      97674      97760   0    Initial     87    50    Marginal
gtctctgaattcgcttaagctttcccatgccagcacccccactgaattccttttcttttt
aaagaggagaatgaggtgcgaacaatggtggatccaaactcacgcagtgaccccaagctt
caagaactgatgaaggtaagaagaaatcaggagcggcttcaggtgcctcactgacccacc
ATGTGTCCATATGCCACCTGCTCTGTGCAGGTACCCCACGAGCCCCTGAGAGAAGGTAAA
AAGTCATGGCAGCCCCTGCCTCAGGCA
gtgagttgtctagcagatggccatcgaaaacgtaaccgattgtttaagtgtgggatgtga
caaatgcccagtgagtggtgctggtcacagcaccagacagttcagtacaggtaagctcac
gatggccaggattccagagtgcacaaaatgcttattttctcaaggaccctcaaaagcagg

Exon 21 +      99406      99528   0    Initial    123    79        Good
ccaggagtattcagaagtaaaatcaaacccatgtgagggttgggccatctcactagggac
tggaggactgagggcagtcatctcagaggagatgtgtaaatgtcccttctgtctgctgaa
gggagtctgtgccctgaccccagagtttaagagaaaggaggcagccttggctaggccgcc
ATGCAGCCCCTTGCTCCCCTGGATCACAACCGGAGCCTCACAGGCAGCTGGGCTGTGCAT
GTTGGGTATCTGGCCTTTCCTGATGCAGTCTGTGCTGCATCCATAGATGACTGCCCCTGC
CCA
gtgagaccctgagccctcacctttctgtgcaggaagaagatggaacagttgaggtgcagg
ctgtgcctgccgctgcacactctccggggtgctgggcctgtgtgggcaagggtaggggga
aaggggctagccctgggcttgctcctatcagagggcgctcaccatgctagaatgggtatg

Exon 22 +     101492     101594   0   Internal    103   100   Excellent
gagcccaggagtttaagtccagcctaggcaacatagtgagaccccatctcaaataaaatg
aaacttaaaatctaaagttaatttggattttaattgtttaggataagaaagctggtctgt
aagaaaataccccataactcttttcttactattgcacattccctttctctctctctgtag
GTATTAATTGACTGGATTAATGATGTGTTGGTTGGAGAAAGAATCATTGTGAAAGACCTA
GCTGAAGATTTGTATGATGGACAAGTCCTGCAGAAGCTTTTCG
gtaggagagttgagtgctgcaatggatgtgtgtttaattgcaggtggttggatcacctac
ttgtagctagaaggagttattctcagtttacagtggcttacctggaaatggattacaaat
gtgtggagcatggaataacagctcagtgaaggctttagatgtcctcttggaatgtttcat

Exon 23 +     111400     111453   1   Internal     54    60    Marginal
gaacattgccatcataccagatagttctgctgaatagccctgcttgaagatcctcctcct
ataatctgattttaggattgttgatatatgctgctattcttaaactgaaagagttatttt
ctcatctcaaactcaaaagttagatgaaagttttttattattattctttataaataatag
AGAAGCTCTCTAAAATGTCTTACTACATAGAAAAAGGCATGGTAGAGAACGACT
gtgtgtgtgtgtgtcaagggacacatacaatgtttgtatgcatagaatatttctcgtaat
agtcataataaactgtctctatgaatgggactagggaacttgggactgccatggaaagga
gacagttttcacagcttgaattttctctgtttgtatattatcagtcttattgaaattggt

Exon 24 +     119751     119827   1   Terminal     77    56    Marginal
ctttaaggatgttaaaatgtgaaaaatatgtgccttagaattgattaaatatgacacatt
aagtaagttaccttccaggtgggtttaaaaggaaagaaggtacttaaaacagataagtat
gattggacctgaccagactgtactacaggaatgtacaaaatgccttgactaactctacag
AGAAGGCTTTCCAGTCGGAGCACAGAGATGTCCTTGGAGAAGATAGAATTGAAAAGAAGG
AGAAAACTCCAGAATGA
tagagttcaaatatgacaggctaggttaaatgcccctgggatctggggattcaagtcatg
atcatgaggctctcacagtactgatgctgctggtgccaccataaggtgatgaggggacag
cagtgtccctctgctggtaggcatccagtatctattgttgcaagagtgcatgcatgcatg

Exon 25 +     120103     120243   1   Internal    141   100   Excellent
ccaccataaggtgatgaggggacagcagtgtccctctgctggtaggcatccagtatctat
tgttgcaagagtgcatgcatgcatgagtgcatgagagaccgaataactgagtaagtgcat
gcagtagggttgtctggggcccagcataacagctgttctcttttcccttgtcaccctcag
AGAAACTGGAGAGTGAGAAGCTAAATGTGGCTGAGGTCACCCAGTCAGAGATTGCTCAGA
AGCAAAAACTGCAGACTGTCCTGGAGAAGATCAATGAAACCCTGAAACTTCCTCCCAGGA
GCATCAAGTGGAATGTGGATT
gtgagttgaacaaaggaaaggggcaccattaaacaatgcctgtggtccctgccatggggc
ttccccaagaagccatccataagcttggcaggcttcaggggagggggtcaaactcattta
tctttgaacaagttgccccgcttcctcagaacttggaagaagttccatccatacccttgg

Exon 26 +     126508     126591   1   Internal     84    68    Marginal
cacacaaatgttcaacagtggctagaatttgttttaattgaaaagatggcagatttttat
tctaaagaatattttgaaataggaaaaaaattaagactatccactctagtgtaactattt
tcattttttttttttaatgaaggcttttggggaatctttacaacctgtacatccacatag
GTTCTGTTACCTCCATTTGTAAAGATGAGCAAATTAAGGCTCAGAGGCCTTCGGTGGCCT
ACCCTACCCAAGGCCATGTAGCCA
gtaaataagtggtagattataaagttagaattcaggctccagtctgcctgaccctctgtg
cacctcactgagtctttttctcctcatctagtgagaaaactacaacccagtgtgaccctg
ccttctctggtgtaaatggcttgactttgagcacatgactcagcagctttggcagccccc

Exon 27 +     127959     128074   1   Internal    116    99   Excellent
tccaaatacctcccaccaggccccacctccaacaccggggattacatttcagcatgagat
ttgggcagggacaaatatccaaactctatcagtggggtactactacactttgaacatctg
cttatattgcctagaacctggaagaagatgctgtaatttttcaatcttctttcatttcag
CTGTTCATGCCAAGAGCCTGGTGGCCATCTTACACCTGCTCGTTGCTCTGTCTCAGTATT
TCCGCGCACCAATTCGACTCCCAGACCATGTTTCCATCCAAGTGGTTGTGGTCCAG
gtaagacaggtaacactacaaacatctgtgtctttaaagagtcgtggaggtcgagttcct
atggtgcgtcgagtaggtcattagaaggatggctgcatgaatgttgagtgagcctgggtg
tgcagtatattgggaggcactgaatgagctttctgttgcatgttggcttcccctggtaag

Exon 28 +     130343     130417   0    Initial     75    40        Poor
atgtgagcaggagagagggggcttctattttgaaacagtggtcattgcaagcctgtgtct
cctgccttattttgagctcaattataggccatcagaagcctgttgtcagtttaatttctc
ctgtaggctgttttgttagcatgagggagaaaagaggacatgttccataaaatggcatta
ATGCACATCAGGTTTTATGGGGTGTTTTTGCTTTATCAAGTTGAACAGGCACAGAAGCAA
GACTCAGAATTGGTG
gtgagtcacagactgaaccacagggagaactctttagggaacaaataatgggtggaggtg
aatcaggatgctgtgtgaggggttattgaacccagatttcttttccattctatgcagaag
catttaattttgcagaaagttggagatgaggttttacgtctatgaatggccatgcaggac

Exon 29 +     132229     132318   0   Internal     90    95   Excellent
gttcagtccagtccctgaaaatcaggacctcctttcacttccagcattatcttatcttgg
gtgcatttcttaaacaccagtaactttctcattatcaggaatgctcatcagtgtttctgt
atttttctaaagcatagttttctcttctcctcccaacccctttccccacccccatttcag
AAACGAGAAGGAATCCTCCAGTCTCGGCAAATCCAAGAGGAAATAACTGGTAACACAGAG
TATGTCAACACCATTGTTGCCAGCGATTCT
gtaatggaacacagatgtttctctgaaattcatccatttgctgatatttagttttcattt
attgggattgcaggagggattagacttcagccaatgattatagtttagccttttccatgc
attcaaaacatgcctctcaatgcttaaggtacaaacttgggtggggaagtagggagacgg

Exon 30 +     132873     133024   0    Initial    152    55    Marginal
cttagatttgtcttttggtttggggtggttttttttttttttttttcatttatttttaga
aattgggatatcagaacctatcaaaattttgccatggggaacaggagttttctcctcaag
cagaaaaaaaattcatagtgtggggtgagtttgtgatcccgagaactgcaccctggcccc
ATGCAAAGTCAGGCAGTTAGCTTTCAGCATTCCCTGCTCCCCAGACTTTTCTCTGAGTCC
CCCTTGAACAAGAGCAGCATAGTGCAAAGAGCAGAGGCTGCTAAGCCAACCCAACTTGAG
TTCAAATACAGGCTCTGCCACTTACTCACCAG
gtgagtcccttaacctctctgacctcagttgccccacccagagaggtaggaaagatttac
tgtggtcacagctgtgacttcgttcccttgccctctgtagctgctgttccatcttttctc
cagcacagctgacccgtacctgccaagcccatccagtctctaggaggttcctgccctctg

Exon 31 +     136901     137005   0   Internal    105    98   Excellent
tgtacacatgcacggacacagacacaggctcccagggtgagaatcaccccaaatcttagc
cccaaatcacattccagagttcccggcacagtctataccccagaggcttcccatcggtag
ttgaccttgtgaccttgagaggcgcgtggctctgggacccaaggtgggcttccctgccag
GGATCAGCTCTTGTGCTCCACATTGTGTTTCCCTCTTTTTCAGAACGTGATGCCTTTGAC
ACCTTGTTCGACCATGCCCCAGACAAGCTGAATGTGGTGAAAAAG
gtgggaaaggggtgcctgggatggacagagggaagcgagatgcaacagaacattgggaaa
acccatccctgcagcttgcgagcttcctgccagaactggtggcatcacctaacctctgca
cacacagggctttcccccttgccatccatgtacctgtctgttcctcactggatgttgcac

Exon 32 +     137642     137710   0   Internal     69   100   Excellent
gtggccctccctgtgcactcaatggcctttgcagagagagctcctgggcccagggctctt
ggctgggcctgatcctctgctttcaccctcacccttgccctcacgggagtcacggagcag
ccacaggctcctgcactagtgcgagtccccagcttagggcctgctttgcttctcttttag
ACACTCATCACTTTCGTGAACAAGCACCTGAATAAACTGAACCTGGAGGTCACAGAACTG
GAAACCCAG
gtgggtgacagaccccagcacaggtagaggcagggccctgccctacagcccctgttccaa
gtggcccaccacacttggccaggagggctttcccagctgagggggatgagggcatgggaa
tctgtcctactctgaggggtggactgagtctctgtggattttttccaactttttattatg

Exon 33 +     141255     141356   0   Internal    102    98   Excellent
ccagccagacgtggggcagagcagacctccttgtctcgggccactgcccctacccccgag
ctagcagcctggctggggtggtaggcttcaggtggcatagcacagaagttgatgggcccc
ctggatggggattggctgggaggctcaggggccagtgccatcacctggctcttcctccag
TTTGCAGATGGGGTGTACCTGGTGCTGCTCATGGGGCTCCTGGAGGGCTACTTTGTGCCC
CTGCACAGCTTCTTCCTGACCCCGGACAGCTTTGAACAGAAG
gtaaggagaagggacatcaagggaggccccctagcccacatcccctgactcatgtgccca
cacccatgctggggctatccagaaaaaaggcagaagcttcccctctgctcaacgtcttca
gtgcctggaggtgggacccattataagagctgagctgggaaggagctacctgcagaccac

Exon 34 +     151494     151570   1   Terminal     77    86        Good
ccccagcacctctaccctcactgccccctgctctgaattctcgctgcccactctacccat
ctgccccgaacatgctgggtacatgggattgggtggtgggtggaagggaggggcagtgta
tgccagctttggaacatgtggccccatggaaacaattggtgttttttgttttctacgcag
ACATAGTCAACTGTGACCTGAAATCTACACTACGAGTGTTGTACAACCTCTTCACCAAGT
ACCGTAACGTGGAGTGA
ggggctgccctgggcccaccactgcccaagagttcttgctgttggcgtactggaccctcc
tccgaactgccttaccctgcttattcctgtctcttgcactgtgctctcccacaagtccag
ctgcaacccagagatagtggaaactgaaattaggaaggaaatcatcaataactcagtggg

--------------------------------------------------------------------------------