--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (71953 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1408   0   Internal    208    78        Good
atatagtaggcatttacatcagtgagtgttagcaatatcatggtgtgcagtggaaggact
tgagctagaccctgaaggaagggctgtataattttgattctttgcaattttttaacatgt
atttccttttggtcaaaaataataaaagagttatattgttcttatttctgattctagtag
CTGCTGCTGGTGGTGACAATGTCAAATAACGGCCTAGACATTCAAGACAAACCCCCAGCC
CCTCCGATGAGAAATACCAGCACTATGATTGGAGCCGGCAGCAAAGATGCTGGAACCCTA
AACCATGGTTCTAAACCTCTGCCTCCAAACCCAGAGGAGAAGAAAAAGAAGGACCGATTT
TACCGATCCATTTTACCTGGAGATAAAA
gtatagtatttgattttcttctcatcatttatatgctttaaaaaaattattttgggtaac
ctggataaaagatctgttgtctttgacttaattttcctttaatgttttctttctggttaa
atatttccctttctccctacagtggctgaagcaaaatggaaaatagacctatttttatac

Exon  2 +       3871       3931   1   Internal     61    76        Good
tccctcaatttagatgtgtatttatttttaatattgtatcttatcaaccagtgttcttga
tctctataaataggctttcagcccaagtgtctacatgtagtgaaagaggactttttaaat
taaaaagtttaaattgttcttgctgactcaaactagaaaggtaataagattctcatccag
TAGGCATCATCAAAACTAAAAACATTTATGTTTCAAAGGGCATCATCCGGAAAGCAAAAA
G
gtaacacacagaaaggagaaaaatttcccaaattacatattttataatggatgtgtatct
aaaatatgtgaagaagaactattgcaagtcaacaaccgaaagacaagtaattttaaaatg
ggcaaaatatctaaatagacatatctccaaagaacatatacaaatggccaagaagcacat

Exon  3 +      13745      13845   1   Internal    101    86        Good
taaacatgcattgagtatctgctccaatccagatccgtaactgagctcttctacatatgt
gaaatattaatagatagactttgccctctcaaggagactacagctcaataaagagctaaa
ataagcctaaaaacaataatgttcctgttttttatttccttttgcctgtttctcttgcag
CAAATAAAAAGAAAGAGAAAGAGCGGCCAGAGATTTCTCTCCCTTCAGATTTTGAACACA
CAATTCATGTCGGTTTTGATGCTGTCACAGGGGAGTTTACG
gtaagtcctgggtcacagaaaggtctttagtcttttagagttctggctgtgcactgttag
attcaaccctttctcatcttcctgatgcttctatctttgcctgagaccctgattacaatt
ttctcacgttcatgagtgggacactttcatcgccaaaattgtatccagagaagcctttcc

Exon  4 +      14351      14498   0   Internal    148   100   Excellent
actaattcaatgagaaagatattataaaagaggcttgtgtaaactctgagagtatagaga
gaaaggaatgactaataaatgcatcttttgctgctagcaagtgtcaaagttagctctgat
gttctttcaggctcccctgtgactgtgccttcctgttagtcttgcatgtctctcttacag
GGAATGCCAGAGCAGTGGGCCCGCTTGCTTCAGACATCAAATATCACTAAGTCGGAGCAG
AAGAAAAACCCGCAGGCTGTTCTGGATGTGTTGGAGTTTTACAACTCGAAGAAGACATCC
AACAGCCAGAAATACATGAGCTTTACAG
gtatgagaactgcgtccagggcagtctcagcaagagatggttttaatctgggtgggaaag
ctcacatgcctattagtctgggatgagagaagaaagtagtggaaagagtggaagtggcac
tttaacgtggaattttggaatttgacagccaagatgatggactttgcatcaaacttgagt

Exon  5 +      19374      19454   1   Internal     81    51    Marginal
aggattaaagaaggtgatatgtataatgcatttagcatgatatctagcctgtagtaccag
tcatactattactattctctgaatctggcacgtgcttgaccagatagacttcttttgctg
tccagaaaaatttaactgtaactgttattgactaagtcccttgtttttcttcctgtgcag
ATAAGTCAGCTGAGGATTACAATTCTTCTAATGCCTTGGTAAGTCTTTATTTACTCTATT
TTGATGTGGGCAGATGTGGAG
gtaaggatcaagacagtgtggtagaggcagagcctgagctgggaggcactcatattagtc
actcctgcacccttggcctcagaattcctatctatccaataaagaaattagatataataa
atagggggtatccctttcagctttaatgtcctagaaattctttctttgtgataatttttt

Exon  6 +      34722      34841   0   Internal    120    90   Excellent
agaagagggagaaacagattgagcttctgagactagctacacaaaggtgagagcttggag
gctaatgtgtatttcagaagggatatcaggatggggtttctcgtgggaggtttggtgatc
ctgatagttaagttccatggcagctggaccagatgcatcttgcttttcttctttgcacag
AATGTGAAGGCTGTGTCTGAGACTCCTGCAGTGCCACCAGTTTCAGAAGATGAGGATGAT
GATGATGATGATGCTACCCCACCACCAGTGATTGCTCCACGCCCAGAGCACACAAAATCT

gtgagtctttggggacctggccagttttgtgatttattagagtaagtggggagagggagg
agttggtgctgatacctagaagtttaatattctggtaggcgtccttagattttggagctg
gtgaaatcactgaactaccttgactaaaggtactttctgtatgattaaagacaaaaaatc

Exon  7 +      37897      38071   0   Internal    175    85        Good
ggccattttacccagaatgggtgggcctgggcacagaggaggagtaatatagattttgac
ataagagaaaggatgagtttattggggtttgctctgtggatgttctaacctcacatctag
gagaggttcccctatgctaacaaaggctggtcttgccaaaattttgcactaataatgcag
GTATACACACGGTCTGTGATTGAACCACTTCCTGTCACTCCAACTCGGGACGTGGCTACA
TCTCCCATTTCACCTACTGAAAATAACACCACTCCACCAGATGCTTTGACCCGGAATACT
GAGAAGCAGAAGAAGAAGCCTAAAATGTCTGATGAGGAGATCTTGGAGAAATTAC
gtaaggaatttgtagctttctgaacctttcttcgttttatgactggtcaagcacagagat
ttgctggtcgtaggcttggtccatgcagctggctggccatgcttggtaccttaggcacag
actgcttctcctcaccctgcccctgaacctcccttccctgtctcacagccctggttggat

Exon  8 +      38240      38273   1   Internal     34    78        Good
tggagaaattacgtaaggaatttgtagctttctgaacctttcttcgttttatgactggtc
aagcacagagatttgctggtcgtaggcttggtccatgcagctggctggccatgcttggta
ccttaggcacagactgcttctcctcaccctgcccctgaacctcccttccctgtctcacag
CCCTGGTTGGATACTATGTTAGGATGGAGATGTG
gtgagagtgtggatagcttactttgagggcagggcatccctcacccctaggcatgtatta
tagcgaagacaaatagtttttctctaatgaatagcctagaatgccatgttgagaaagact
gaggacctagtggaaaagggcactgtgatcaattattgatgttttgccattgacctagga

Exon  9 +      44452      44500   2   Internal     49   100   Excellent
cattctctgtactacctcttatagcttcttaaatgtgagaatggatgctgcagggagagg
attatttttactgctcttgtttttgacactcacagattgtgtgtagaactgcatttgaca
aatatcactttattgaacactgtgtttttttccctctttctccgccaccttactgttcag
TGCTTCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAG
gtgagtatccaccacccactgttgctcctttagttctgtttctttttatttgggattaat
ttttagcccttgttaggtcaacaggaacagttctaggtttttttttttttttttgggatg
gggtctcactctgtcatccaggctggagtgcagtggcgtgatctctgctcactgcagcct

Exon 10 +      45435      45544   0    Initial    110    63    Marginal
atcctcatttatttggaggcagctttttgtccctctcatttcattaagccatgagaacta
tagctaaagcctgctgacccaaggtcttatattcagtagaagaaagatatgaagggaata
tagagtacttgaggtttccttgcattttaatatttggttgcagagtaggagtgtcagcca
ATGAACTGTGGATGGCAGCTGCCCCAGAGAAGTTCTTACTTCAAAGAGTACCAGTACACA
ATAATTGAGAGAGGCACCTCCTCTTCCAATGAAAATAGAGTTGGGCTTCT
gtgagggaggctgctagaaacgtgcttctatatttttggtggttgaaaccacgtggcacc
ctggagaagtcatggttaataggggtagcacatatctcactaggctcttgtgagttttta
caagtgttaaagccaaatattaaggctccacctagggtaagccaagttttaaaaatcatt

Exon 11 +      49808      49920   0   Internal    113    96   Excellent
gctggcttgagacctcactttgaagaccactggtctacatagacaaactgtgaattactc
gagggctaagactgtatcttactcatctttgtttcctgagtacttaaggtctggtactta
gcaggtgctcaataaatgggaatgactatggttgcacattgaatatactcttgatttcag
GTGGCCATTAAGCAGATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAATGAG
ATCCTGGTCATGAGGGAAAACAAGAACCCAAACATTGTGAATTACTTGGACAG
gtatggagtggtgggtcccatcagagggaaagggcctttgggactgattggtggtgaagc
tgttagagaagagggcagtgccagccctcagaactgcctccatttatgagtcttctgtga
tgctgagctctctgtatgtgaccctgtgtaatgctggacaccttttttgctgggaaatcc

Exon 12 +      52976      53093   2   Internal    118   100   Excellent
gattcaaagttagtgattctgttccccagattctgcttttccccaaagtaaagaaccttt
tactttactttgtgctaagacgtagtttcactctgtgtatatgcttagcctttgaaaccc
agtgctatggctcagtgtactctgattgttctctctcaccctttatctgtattcctgcag
TTACCTCGTGGGAGATGAGCTGTGGGTTGTTATGGAATACTTGGCTGGAGGCTCCTTGAC
AGATGTGGTGACAGAAACTTGCATGGATGAAGGCCAAATTGCAGCTGTGTGCCGTGAG
gtaaggccaagggccaagcagtcttgggtagaaagctgcctccatattcctgtctcctga
agttccctgtacagtgagatctcagcctgggctctgtggaattggtagaaattagtgctg
acactgctatcattcctgtattgtacctgtgtttgtcatttctatcaccatgattttttt

Exon 13 +      56316      56415   0   Internal    100   100   Excellent
agatggaagacttgtttctagatctggctctgcgattgatttggggcaagtccttttact
cactggggccttacttcctttattttaaagtgaagaggttgaattagtggattttctatt
aagtcttctgtattatatgtatgtcctttctttctccccctgcccacaccacttcaatag
TGTCTGCAGGCTCTGGAGTTCTTGCATTCGAACCAGGTCATTCACAGAGACATCAAGAGT
GACAATATTCTGTTGGGAATGGATGGCTCTGTCAAGCTAA
gtaagtaggagccttaggaatgataatacttctctgcctgtggggccctgtctcctgtga
gatggtcatcatataatagtaactacgacactcaccaaagggtctttatgatttcatggg
atatgagggctgttttatattttctgtattaatcataggatatcatttcattattttttc

Exon 14 +      57457      57653   1   Internal    197   100   Excellent
ataggaaataggctaggagctagacatgaaggtggtagtcaagtgactttggagagacaa
aggatagcagagctggaagccaggcggatcttgtcacctatgtgtaggtacacagtcaac
acttactgaagtgagtgtatatcctaaatgtatgttctttctcttatttttcttttctag
CTGACTTTGGATTCTGTGCACAGATAACCCCAGAGCAGAGCAAACGGAGCACCATGGTAG
GAACCCCATACTGGATGGCACCAGAGGTTGTGACACGAAAGGCCTATGGGCCCAAGGTTG
ACATCTGGTCCCTGGGCATCATGGCCATCGAAATGATTGAAGGGGAGCCTCCATACCTCA
ATGAAAACCCTCTGAGA
gtgagtgttaccagttctatttcaagttatttgggctgttgtctctagtcccaggaaata
agaatccagggtgttctctgtggttttcaacctggagatcccttttctggatacaactag
tcactgttgaacttaaagtataaatggccaaagaaaaggaatattagaagtcactcattc

Exon 15 +      59301      59402   0   Terminal    102    45    Marginal
aaaggacattagattagcatggacaatttatcccttgtaacagagcatctcaacacaggt
gcaaataggttggtaatcttggtgtgggcaaatgtgaaatttattctgattgcttttatt
ttctcatttattcccacctcccatccagtgcaggaattccctgtgcactgttgctggtag
GTGGTCATCTACATGCTCATGTCATCCTTGAATATCTCTGATTATTGGAAATTGCTTCAG
TGCACCAAACTGAAACTACCTTCTGTAGTTTCTATCCTTTGA
tcccagctttgcctctgactccacatacaacatactcttccctcccttagaacggccttg
cagatatttgaagatgataattgctgggatatgttggaaataagacagaatgatcctaga
cataggcatatttttttatttttttatttttattttatttttttttttgagatggagtct

Exon 16 +      60812      61009   0    Initial    198   100   Excellent
agacatgtgagatgggcattatcatcatccctactttacagacagggaagttgtacatag
tcccatggcctttaaatgttcaacctgatccttaggtcatactctttccagtatatatac
acagctgctactttgcatcctagagcataaagcagctgaccatatttctagaacttgtat
ATGGGGAACAAGAGAGAGCCTCATTTGGAGCTCAAGGTGATTCACCATTTTTATTGCCAG
GCCTTGTACCTCATTGCCACCAATGGGACCCCAGAACTTCAGAACCCAGAGAAGCTGTCA
GCTATCTTCCGGGACTTTCTGAACCGCTGTCTCGAGATGGATGTGGAGAAGAGAGGTTCA
GCTAAAGAGCTGCTACAG
gtaactgtccttatgcagggaagcacctaattcagggaatcactaaaccaggcctttttt
acttcatgtttgtaaggtactggatattatagaactaggcttctcttctaccacttccta
cactcactctgttcctactgcccttttatccctgggcctttgctcatttattttcttagc

Exon 17 +      64284      64410   2   Internal    127    87        Good
tgagatatgtcccatcaatacctaatttattgagagtgtttagcatgaagggttgttgaa
ttttgtcaaaggccttttctgcatctattgagataatcatgtggtttttgtctttagttc
tgtttataccttggattacatttattgatttgcgtatgttgaactggctttgcatcccag
GGATGAAGCCCACTTGATCATGGCGGATAAGCTTTTTGATGTGCTGCTGGATTCGGTTTG
CCAGTATTTTACTGAGGATTTTTGCATCGATGTTCATCAAGGATATTGGCTAAAATTCTC
TTTTTTT
gttgtgtctctgccaggctttggtatcaggatgatgctggcctcataaaatgagttaggg
aggattccctctttttctgttgattggaatagtttcagaaggaatggtaccatttcctcc
ttgtacctctggtacaattcggctgtgaatccatctggtcctggactctttttggttggt

Exon 18 +      70379      70465   0   Terminal     87    88        Good
gtagatgctgccaaacagttttccaaagtggtctgttttaagatgtccttcaatttgggg
atgatcagaagctttccacacagcaccctttacaaacaaagatgcctttatgtcttgtaa
tggttactggggaagaatgttaaatagtcatgtgtcttttgctatttttctcctttctag
CATCAATTCCTGAAGATTGCCAAGCCCCTCTCCAGCCTCACTCCACTGATTGCTGCAGCT
AAGGAGGCAACAAAGAACAATCACTAA
aaccacactcaccccagcctcattgtgccaagccttctgtgagataaatgcacatttcag
aaattccaactcctgatgccctcttctccttgccttgcttctcccatttcctgatctagc
actcctcaagactttgatccttggaaaccgtgtgtccagcattgaagagaactgcaactg

--------------------------------------------------------------------------------