--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6633 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        968       1004   2   Terminal     37    68    Marginal
tgattttattcttttttctctttttagcttctggagcaagattgaatgtctctgactggt
aattattctatagataaagctgtaatgagtttcgacacacctcctgtttcttgttttccc
ccctattttaaaaaatgatgccccctatattctgagactgacctgtatttccttaaccag
GCCTGTGGCCCGGGATGCTGAGGACCATCAGGTGTGA
actgagcttaaaaataaattccatggctgcttttgtcacccttgcatgctggtcactctg
ccctcagcaggtatggatgatgacgccactcacagattcaaagaaagggcaaactggcag
agtgagtcattggatgttgctggcacagctataaagatccagtggcccaagttgtgtacc

Exon  2 +       1075       1177   1   Internal    103    72        Good
ttcttgttttcccccctattttaaaaaatgatgccccctatattctgagactgacctgta
tttccttaaccaggcctgtggcccgggatgctgaggaccatcaggtgtgaactgagctta
aaaataaattccatggctgcttttgtcacccttgcatgctggtcactctgccctcagcag
GTATGGATGATGACGCCACTCACAGATTCAAAGAAAGGGCAAACTGGCAGAGTGAGTCAT
TGGATGTTGCTGGCACAGCTATAAAGATCCAGTGGCCCAAGTT
gtgtacctgaattcaagcagtgggacaaatgagggtttggcatgcagctcgtcatcttaa
gagttactatcttcttgccctggtgtttcgccgttccagtgccccctgctgcagaccata
aaggatgggactttgttgaggtaggtgaacgactcaggaccacattattacatggtgacc

Exon  3 +       1219       1377   0    Initial    159    52    Marginal
gtcacccttgcatgctggtcactctgccctcagcaggtatggatgatgacgccactcaca
gattcaaagaaagggcaaactggcagagtgagtcattggatgttgctggcacagctataa
agatccagtggcccaagttgtgtacctgaattcaagcagtgggacaaatgagggtttggc
ATGCAGCTCGTCATCTTAAGAGTTACTATCTTCTTGCCCTGGTGTTTCGCCGTTCCAGTG
CCCCCTGCTGCAGACCATAAAGGATGGGACTTTGTTGAGGTAGGTGAACGACTCAGGACC
ACATTATTACATGGTGACCATTGTGGGCTCTTATTTCGT
gtgtgtgtgtatgtgtgactgcatggtataatgataaatacacacattaatattacacat
gaaaacattttattctatctatgtgttcatttttctcttctaattttaagaaaaaaatta
attttttgtagcccctaaaagtgtttttgggccctaggcactgtgccttctgtgcctaat

Exon  4 +       2655       2848   0   Internal    194    82        Good
tttcactgtggcataaagaatcagggatggctgccatcatctgactgagaacaggagact
taggaaggccagactaagtaccgtccttctgagaccctcaaagaaggctatgcccagggt
aactgatatatgggtcttccctattgactcttagtactcatccttcttgatctgattcag
GGCTATTTCCATCAATTTTTCCTGACCAAGAAGGAGTCGCCACTCCTTACCCAGGAGACA
CAAACACAGCTCCTGCAACAATTCCATCGGAATGGGACAGACCTACTTGACATGCAGATG
CATGCTCTGCTACACCAGCCCCACTGTGGGGTGCCTGATGGGTCCGACACCTCCATCTCG
CCAGGAAGATGCAA
gtggaataagcacactctaacttacaggtgcttgttactaaggcctagaggataatgtgt
ggggtgatgacctcaaagggctttctaccaggtctctcctggaggtacctctactctctt
ctgctttcattggcagcccgctcaaagcccaaaatctccctcagagaaggtaatactacc

Exon  5 +       3605       3753   2   Internal    149    81        Good
tgcatgtttaattccttaagtttctgatttaattagtctgaaattagctcaactttataa
ataaccaaaatgagtcctaaaactattaaatgattctccccaaagtagaattattcatgt
ttagagctaggataattcccattcctctgaactatttcatttagagattgctttcctcag
GATTATCAATTACCCACATGATATGAAGCCATCCGCAGTGAAAGACAGTATATATAATGC
AGTTTCCATCTGGAGCAATGTGACCCCTTTGATATTCCAGCAAGTGCAGAATGGAGATGC
AGACATCAAGGTTTCTTTCTGGCAGTGGG
gtaagaaattgacatgggaagaaggatatgtatatgccctgtgtaaaggacaaagggttt
ccatccttaaacaaaaacctagcccccctattaaagtttctgagaaaaaaagtctgacaa
aaccctactgcaaagcaaatcctgtaatagggaagacatttttagtaaaatgaagcaata

Exon  6 +       4971       5127   1   Internal    157    90   Excellent
atcttgccattctgttttctacttactttctttccctccttgcctaccttttcctttacc
ctgtaacatttgccctttcctcgttttctgttctctcctttttctttgtcctatttcaca
cactttcagcattccctatgcatagttaattttatcttttttttttctataatttttcag
GATATAATCTGTTCCTGGTTGCAACTCATGAGATTGGGCATTCTTTGGGCCTGCAGCACT
CTGGGAATCAGAGCTCCATAATGTACCCCACTTACTGGTATCACGACCCTAGAACCTTCC
AGCTCAGTGCCGATGATATCCAAAGGATCCAGCATTT
gtatggtctgtgctgcttaaggaagagaagggagatctgggcaggaaaatttcacctgaa
atttactgttgttttttttttctgtttccataggagaaaaatgttcatctgacatacctt
aatgttagcacagaggacttattcaacctgtcctttcagggagtttattggaggatcaaa

--------------------------------------------------------------------------------