--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13910 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        339        441   0    Initial    103    44    Marginal
gtcagtggggcagaagggaggtgggggagggaatcaagttcacctttagacatgctacga
tggaggtgcctatcaggcattcaagtgaagatgtcaaggagccacctagagattcaagtt
tagagccccagggagcagagctgcagatgcagatttggaagtctttgctgtgtaaataca
ATGCAAGGTGTGAGCCTGGATGAGATCTCAGAGAGCAGAAACTGGAGAGAAAAGAGAAGT
CCCGAGGATGGAGTGGAGGAGGGGGACTCGAACAGCTGGCCTG
gtgaaagacgagaggcacaaagggagcagccagagagctaggaagaaaactgggagagca
tagtgtccaaaggccaagtggtttcaaagaaacgggaatgatcaaccatatctaatgctg
ccaataggtcaggatgagatctgagaattgattactggatttaacatcatggaggtcact

Exon  2 +       1270       1360   0    Initial     91    83        Good
tgtaggatagaatttcctgcctcagcaggggcaaggaggccttggggctgggctgggctg
ggctgggtgtggcactctccctgccagcttctacaacctggggagggaacaaaaacctgt
gggtgcctcagaccacagcagagctcacagaacctgcgggagccaggctgacccgccagc
ATGGTAGAGTTCGCGCCCTTGTTTATGCCGTGGGAGCGCAGGCTGCAGACACTTGCTGTC
CTACAGTTTGTCTTCTCCTTCTTGGCACTGG
gtaagttgggctgcactgtaagacgggagaccaccgcactcaggtggggcagagcagcca
caccaggtgcacacagcacattgatggtggcaagacatttatcctaaagggggctttgtt
gcgctcagagcccctgcccagagagaactcctgggcctgcccagaggcttcttgggggtg

Exon  3 +       3373       3567   1   Internal    195   100   Excellent
cctctcagggactttgtctcctctttgaatgccccggaagctgctgtcttcctcctgggc
ccgaggattggacaggacagtgctgctagtgccaggcctatgggcagagttcagtctgag
caatctcacctgccttcctctcagacccctgtccctgacagctccttcttccctccccag
CCGAGATCTGCACTGTGGGCTTCATAGCCCTCCTGTTTACAAGATTCTGGCTCCTCACTG
TCCTGTATGCGGCCTGGTGGTATCTGGACCGAGACAAGCCACGGCAGGGGGGCCGGCACA
TCCAGGCCATCAGGTGCTGGACTATATGGAAGTACATGAAGGACTATTTCCCCATCTCGG
TGAGTATTGAGGCTG
gttggggttggggagggagttggctggggtgtggtcagggccagagtgccgacgtctcca
tgggagaatatggccctgcatgcactgaggagggtactgggctgggaggcaggagctagg
gcttccgctactatgtgacctagagaagagtccagcttctctccgatcatggtttcgcat

Exon  4 +       6161       6264   1   Internal    104    58    Marginal
aggcaggcctgcagaggaggctggggaggccctcaggtcagagggtggaggccattggag
gacattccgcaggactgggactgctcacctgaaagttctcccggggtgtcttcagccagc
ccaatggcctcaaaggacagcatctggccctctttgcacctggagcatttccatttgcag
GTCTGGCAGAAATGCTGAGGCAGCTCTGCGCCTACCCTATCAACGTCCGTCCTTCCTGCT
CCTTCCCCAGCCAGGTGGCTTTTGAGGAGGATATCTCAACCTTA
gtactgttgacactggtgggacacaggcctcgatttgcagaaattctatgtgcatctttt
tgtttctttgttttggttttgtttttgtttttttcgagacggagtttcacttttgttgcc
cagtctggaatgcagtggcgtgatctcggctcactgcaacctccacctcccaggttcaag

Exon  5 +      10816      11020   0   Internal    205    89        Good
atatctccaggtgctgtcacataccatatctgaatcttcgtaagaacccagggtggtcag
acatatggatgaagacctggaggctcagaggggaggtttcccaaggtcacaccagtgagt
ggcagagtcagggctggtacacaggccccgccctggctcagcaggttgccgtccctgcag
CTGGTCAAGACTGCTGAGCTGGACCCCTCTCGGAACTACATTGCGGGCTTCCACCCCCAT
GGAGTCCTGGCAGTCGGAGCCTTTGCCAACCTGTGCACTGAGAGCACAGGCTTCTCTTCG
ATCTTCCCCGGTATCCGCCCCCATCTGATGATGCTGACCTTGTGGTTCCGGGCCCCCTTC
TTCAGAGATTACATCATGTCTGCAG
gtgagtctttctacccctgagcagctcaggaaggtaacaaattttcggaagggttgccaa
tagttctgtacttcttccaagagcgtgtgcagtaggagaaggaggctaggcccaaagaag
cacttcctacagcaccatgctgggcgctgagtccatcagggggttgggaagagggagaag

Exon  6 +      11351      11525   1   Internal    175    90   Excellent
gtccatcagggggttgggaagagggagaagactcagggagctcctagctggaatggggtg
cagtgggggaaaaaccccaggcctcagtaggcattgctggtgatctctttatgggctaca
tgtactttcatagcccctgctccctcaccccatacctgacccacttttctctttccctag
GGTTGGTCACATCAGAAAAGGAGAGTGCTGCTCACATTCTGAACAGGAAGGGTGGCGGAA
ACTTGCTGGGCATCATTGTAGGGGGTGCCCAGGAGGCCCTGGATGCCAGGCCTGGATCCT
TCACGCTGTTACTGCGGAACCGAAAGGGCTTCGTCAGGCTCGCCCTGACACACGG
gtatcaagcctctgggaagagcactctgggttcagttggcaattggcaaggattttattt
tggtgggaagatggcagagacgaatgcagattctattttggtagagattttcagtccatt
cacaattaagattatattttggtgtcttatgcccaaatacctagaaaagtttccacaacg

Exon  7 +      12171      12370   2   Internal    200   100   Excellent
aaggtcagagaatggggctgtgaaggtctgggagataacccaggcctccacctccagccc
aggtggctgacctctgctccatttcttggtcactgagtccctgcaggaagctaaagggcc
tttcagctcgtgccttctctggggcctcccacatgccctctttcctctatttgtctccag
GGCACCCCTGGTGCCAATCTTCTCCTTCGGGGAGAATGACCTATTTGACCAGATTCCCAA
CTCTTCTGGCTCCTGGTTACGCTATATCCAGAATCGGTTGCAGAAGATCATGGGCATCTC
CCTCCCACTCTTTCATGGCCGTGGTGTCTTCCAGTACAGCTTTGGTTTAATACCCTACCG
CCGGCCCATCACCACTGTGG
gtaagtccaggaccaggctgggagggaggaggccaaagggacagggcaggttgtgtgctg
caaggggacatggagatgagccagatttattcctgccctaatggggctcacattctagac
tgggaaacatacacacacaagcagatagaatagaagacagtctgggataggaactatagc

--------------------------------------------------------------------------------