--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5494 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1533       1754   0    Initial    222    94   Excellent
gtccacacctgtggacacctgtgacacctggccacacgacctgtggccgcggcctggcgt
ctgctgcgacaggagcccttacctcccctgttataacacctgaccgccacctaactgccc
ctgcagaaggagcaatggccttggctcctgagaggtaagagcccggcccaccctctccag
ATGCCAGTCCCCGAGCGCCCTGCAGCCGGCCCTGACTCTCCGCGGCCGGGCACCCGCAGG
GCAGCCCCACGCGTGCTGTTCGGAGAGTGGCTCCTTGGAGAGATCAGCAGCGGCTGCTAT
GAGGGGCTGCAGTGGCTGGACGAGGCCCGCACCTGTTTCCGCGTGCCCTGGAAGCACTTC
GCGCGCAAGGACCTGAGCGAGGCCGACGCGCGCATCTTCAAG
gtggggaccccagccccgccccgccccgggtgggagagcccgcctaggaccccgcgggcc
cggcacacgtgttctgtccccctcttcaggcctgggctgtggcccgcggcaggtggccgc
ctagcagcaggggaggtggcccgccccccgaggctgagactgcggagcgcgccggctgga

Exon  2 +       1844       2054   0   Internal    211    88        Good
gtggctggacgaggcccgcacctgtttccgcgtgccctggaagcacttcgcgcgcaagga
cctgagcgaggccgacgcgcgcatcttcaaggtggggaccccagccccgccccgccccgg
gtgggagagcccgcctaggaccccgcgggcccggcacacgtgttctgtccccctcttcag
GCCTGGGCTGTGGCCCGCGGCAGGTGGCCGCCTAGCAGCAGGGGAGGTGGCCCGCCCCCC
GAGGCTGAGACTGCGGAGCGCGCCGGCTGGAAAACCAACTTCCGCTGCGCACTGCGCAGC
ACGCGTCGCTTCGTGATGCTGCGAGATAACTCGGGGGACCCGGCCGACCCGCACAAGGTG
TACGCGCTCAGCCGGGAGCTGTGCTGGCGAG
gtgagcgacgccggctgccaagggcgttggcattcgtcctgcttgggcaaaggggaacat
tctctgggtcagatttgtggttttagaagctgttctgggagaggctgccagcaggcccag
gacaggtggagagccacatccccacctcctcaggccacagcctaagggttcacagccagg

Exon  3 +       3256       3645   1   Internal    390    77        Good
tcccaggaaggggcagcctgtccccgcccacccccgtcactcacggcttgtccccgccca
cccatcactcacatcctgtccccgcccacccccgtcactcacatcctgtccccgcccacc
cccgtcactcacagcctgtccccgcccacccccgtcactcacagcttggtctccacacag
AGCCCAGCCCAGGGGCGCTGGACGTGACCATCATGTACAAGGGCCGCACGGTGCTGCAGA
AGGTGGTGGGACACCCGAGCTGCACGTTCCTATACGGCCCCCCAGACCCAGCTGTCCGGG
CCACAGACCCCCAGCAGGTAGCATTCCCCAGCCCTGCCGAGCTCCCGGACCAGAAGCAGC
TGCGCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGG
GGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGAC
CCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCC
CCATCTTCGACTTCAGAGTCTTCTTCCAAG
gtcagtgaggcccttgcctggggggctgtctccaggggtccttgggagcacctgcctgcc
aggtactcagcagagtccccttcttcagagctggtggaattccgggcacggcagcgccgt
ggctccccacgctataccatctacctgggcttcgggcaggacctgtcagctgggaggccc

Exon  4 +       3734       3852   1   Internal    119    97   Excellent
acccccaggctccgccagcccctccaccccagcctgcctgctgcctcggaactgtgacac
ccccatcttcgacttcagagtcttcttccaaggtcagtgaggcccttgcctggggggctg
tctccaggggtccttgggagcacctgcctgccaggtactcagcagagtccccttcttcag
AGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGG
GCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAG
gtgagaccagagcctcaaggaggggaggccatgtgctcaggcccactgacagacgcctga
tgccctcagagcctcggagagggggaggggaggccatacaccgggtcactgacagacgcc
cgacgccctcagagcctggggagggggaggggaggacacacgccgggtcactgacagacg

Exon  5 +       4146       4206   2   Terminal     61    64    Marginal
agacgcccgacgccctcagagcctggggagggggaggggaggacacacgccgggtcactg
acagacgcccgatccctcctggcagctggaaccctggctgtgccgagtgcacctagaggg
cacgcagcgtgagggtgtgtcttccctggatagcagcagcctcagcctctgcctgtccag
CGCCAACAGCCTCTATGACGACATCGAGTGCTTCCTTATGGAGCTGGAGCAGCCCGCCTA
G
aacccagtctaatgagaactccagaaagctggagcagcccacctagagctggccgcggcc
gcccagtctaataaaaagaactccagaacacgtactggcatcttggctggtggggaattg
ggtccaggctgaacacgggtgaggcccagggagggaggggacctccacggcctccctgca

--------------------------------------------------------------------------------