--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (147292 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3288       3331   1   Terminal     44    78        Good
agaactttcctgggtggtttattctttgagttcagctaggaaaatggcattttctctttc
cagattttggaagggtattcgatttggagcactgtttatttttaattttaaaaggtaacg
tgattgaccaataaactatttcctcagtgtttgacacctgtaacacatgaaactgaatag
ATGTGGGGAACAATGCTGCAGATGACAGCAAAGATTACCTTTAG
ggaggagacctttgactgtgggttgattaggattcattgttttcaatgttcacagttgag
tctgtgtgtgtagatggggtggtggtagtgatgtcctctcacacttactttgagaggtat
atagcatttccctattaactgattaatcatcatcttaggggcagcattcttctccatatg

Exon  2 +      18739      18882   0    Initial    144   100   Excellent
tgaaaatattaaatgttgagattcttgcaaccaaaggaagatagaaaattccaaagaaat
gactatttctggtaagctcctatcccagttatgtaactcagctagaatagcaattttagt
gataaaactgtgtcaaatattttatttagtgtgaatctgacatttgattttccttttata
ATGCTTCTTTTTGTTATTTCAGGGAAGGAGATTACAGCAGAAACTTTTATGGAGAAGTTG
GACAATGGTGCCTTGCTCTGTCAACTTGCAGAAACTATGCAGGAGAAATTCAAGGAGAGC
ATGGATGCTAACAAGCCCACAAAG
gtaaaagatcccaatgcaaaaatcactcttaggtggtagattacatttataattgcttat
aaattgtgtgtaattaaaaaatttattgtgaacggatgcatcaaggtctatactaacaac
aaagtacagagagttctttttaattaggtaacatgttatttgcactctaattacataaat

Exon  3 +      22179      22337   0    Initial    159    75        Good
tggactggctaagaaaatatggtccctatataccatggaataccttgcagccataagaaa
ccaaaatcatgtcctttgcagaaacatgggggcagctgaaggccattatcttaagcaagt
taatgcaggaacagaaccaaatggtctcacatataagtgggagctaaacactgagtacac
ATGGACACAAACAGGAGAACAAAAGACACTGGGGCCTACTTGAGCAGGAAGGGCGGCAAG
AGGGTGAAGGTCAAAAAACTACCTATTGGGTTCTATGCTCACTATCTGGGTGATGAAACC
ATTTATATACCCAACCTCAACAAGGTGCAATTTACCCAT
gtaacaatcctgcacatgtcccctccgaacctaaaataaaagttaaaaaaaaataccgat
tatgacctcactttcactgctcaatacatcaaatttgatctgaggtaaaagttgacacag
ttgctcttgactgaattgccttctctgttcttggcagcatttatatattcacgactgact

Exon  4 +      26181      26237   0   Terminal     57    68    Marginal
atttgtgtcgtgtcctttcctaaaagggcaatgttcctacctgacccctactactagatg
ctgaaactttgtttagttggcagaacccctttctgcattttcatgagatttattctctac
cctccagaatgtgtgtattttatgaaaccgtctggtttccctactattcctgctttgcag
TATCAAATCTCCAATATCAAATATTGTAAAATAGAAGAGGAGCTTGATGACCTGTGA
tgttgaaatatccatggtccctgtaggttatgtcacagggctggagatggtgtataggat
agtaagaattctgttgttactgtcaaacatatgcaaactgattctggaattttctactta
taagaataaagaaaattccattctccaaaccaagagatgaatgttaagtaccaggatatt

Exon  5 +      30095      30129   2   Internal     35    58    Marginal
cattgtagattctggatattagccctttgtcagatgagtaggttgcgaaaattttctccc
attttgtaggttgcctgttcactctgatggtagtttcttttgctgtgcagaagctcttta
gtttaattagatcccatttgtcaattttggcttttgttgccattgcttttggtgttttag
ACATGAAGTCCTTGCCCATGCCTATGTCCTGAATG
gtaatgcctaggttttcttctagggtttttatggttttaggtctaaggtttaagtcttta
atccatcttgaaataatttttgtgtaaggtgtaaggaaggaatccaattttagctttcta
catatggctagccagttttcccagcaccatttattaaatagggaatcctttccccattgc

Exon  6 +      31367      31870   0     Single    504    42    Marginal
aggatcagcaaaattgatagaccgctagcaagactaataaagaagaaaagagagaagaat
caaatagatgcaataaaaaatgataaaggggatatcaccacccatcccacagaaatacaa
actaccatcagagaatactacaaacacctctatgcaaataaactagaaaatcttgaagaa
ATGGATAAATTCCTCAACACAGTCACCCTCCCAAGACTAAACCAGGAAGAAGTTGAATCT
CTGAATAGACCAATAACAGGCTCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAA
AAGAGTCCAGGACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTG
GTACCTTTCCTTCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCA
TTTTATGAGGCCAGCATCATCCTGACACCAAAGCCAGGCAGAGACACAACCAAAAAAGAG
AATTTTAGACCAATATCCTTGATGAATATTGATGCAAAAATCCTCAATAAAATACTGGCA
AACCGAATCCAGCAGCACATCCAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCT
GGGATGCAAGGCTGGTTCAATATATGCAAATCAATAAATGTAATCCAGCATATAAACAGA
ACCAAAGATAAAACATTGTTTTAA
gaagaggtgaccaaacagtataaaacaagaatatttaagaaaatgtgaagtagcattcat
tcatgcagttaattaataagaaatattatgttgtttttctgtgctttgtgatggttctag
tgtttaccatcttttaaaagttattaatttcttgtgctttattttattaggctaaaatgt

Exon  7 +      42807      43067   0     Single    261    43    Marginal
actgttcttggtcattattagtgcagtgaagttagcagcaaagttcaaccattgtggaag
tcagtgtggcgattcctcagggatctagaactagaaataccatttgacccagccatccca
ttactgggtatatacccaaaggactataaatcatgctgctataaagacacatgcacacgt
ATGTTTATCGTGGCACTATTCACAATAGCAAAGACTTGGAACCAATCCAAATGTCCAACA
ACGATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCGGTA
AAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAATTGGAAATCATCATTCTC
AGTAAACTATTGCAAGGACAAAAAAACCAAACACCGCATGTTCTCACTCACACGTGGGAA
TTGAACAATGAGAACACATAG
acacaggaaggggaacatcgcactctggggactgttgtggggtagggggaggggggaggg
atagcattaggagatatacctaatgctaaatgatgagttaatgggtgcagcacaccagca
tggcacatgtatacatatgtaactaacatgcacattgtgcacatgtaccctaaaacttaa

Exon  8 +      44363      44511   0    Initial    149    47    Marginal
ttgaaacaagcagcttgcttctgcaaatgccattagacagctgaaaaaactatgagttcc
caaagtgtgaggggggaaaagtcaccctctaaacacatatccccactgtgaactgaaaaa
tcctgatcatgggagaaggatttaactttacttagagccaaaacagatttaggaagccaa
ATGAAAGATACAAGTAGAAGCAGCAGCCAGAAGAGTCCCATAGGCACTTCCAGTCTTCAA
GTGAAGTCCAGGGAAGCCATTTCTGGCCTTATCTCACAGAGGTCCTTGGGGAAAGGAAAG
CAGCTGGTGGAATTTGGGAGGTGCACAGG
gtgaggtaagctcctaggtgaactttgtaataatttcgactgagcacaaactttcctgag
cagaatcagggggagacggggaaaacaggtagtgcagatacaagtgcagaagccacagat
ggtgtgggtaggcaggcccaggcctgagagccctgcttgctttctcaattgggacgctta

Exon  9 +      50018      50187   1   Internal    170    86        Good
accctaaagactccttaaaaaactcctagatctgattaatgaattcagtaaagttttagc
atacaaaatcaaggtacacaaatcagtagcactgccatataccaacaacgaccaagctga
gaatcaaatcaagaactcaaccccttttacagtagctgcaaaaaataataaaatacttag
CAATATACCTATCCAAAGAAGTGAAAGACTTCTACAAGGAAAACTGCAAAACACTACGGA
AAGAAATCATAGACAATGCAAGCAAATGGAAACACATCCCATGCTCATGGATGGGTAGAA
TTAACATTGTGAAGATGACCATACTTCCAAAAGCAATCTACAAATTCAAT
gtaattcccatcaaaatacaatcatcattcttcacataactaggaaaaaaaaatcctaaa
attcatatgggaccaaaaaagagcctacatagccaaagcaagactaagcaaaaagaacaa
atccgatggcatcacattacccgatttcaaatattctgtaaggatatagttaccaaaaca

Exon 10 +      55561      55597   0    Initial     37    71        Good
tgtataagtattttagaagctataagtatgtatgttggattaatcttgctgagagataaa
atcagtagtcttgatattataaattttactatttatcctgttgactgcttgcacacaatc
ccaatagcttattggtagtaacttctcattttgctaacacaaaatattgaatcctacact
ATGGACACTGTTGTACAATATAGCATGACTCTTGCTA
gtgagtgagtgagcctaaatttctatccaatttaggttcagcttgactgttttctattca
ttattcatattcagtaagtttcagaaaaggtttgaaggtattaaatttttcagttatgct
ttcctgaatttattgaaggcattttatgcatagttatgccattaacttagtgaattttga

Exon 11 +      73128      73164   2   Terminal     37    95   Excellent
agaagtaaagagacggggttatactgtctctagaattaggtgggatttataaattttcct
cccatttaagtttatagcatttgccttatttctggattttattttatatattgttattat
atattatattaaatgagcacggtgattagggagcccgctgaataaacattttaattatag
CCAAGTCATCAAAGAAGAAGACAAGCTGCCCAATTAG
aaaatgcctttaagaatcacctttcctccagctccgagtctggcataaattgccccttgt
tacaggatgtaaaacaaattaaaatcttggttaatgaaagtgaattataatggccttgtc
attttcaaggtaatacattatgtgaatagttcctcccacccaaatattttaaaattgtga

Exon 12 +      74320      74341   2   Terminal     22    53    Marginal
ataaacatcactttggaaatgattcccagtgagtttctgattctctgccatgttttcctc
tcgggacacttaggaagctcctttgcgagctgtgggcttctctgagttctgagatggctg
aatgagaccacttatttttgttctcatgggtaaaacttacttttattttcaactaaatag
AGCTATCATCACTGAAGAGTGA
aatccctctgctaatatttcagaaaaatatcagtttctgaatataaaatatgtgtttgac
ttgtgaaaagtaaaactgtgtaaaagcaagttaataaaacctcaaagatatttttactga
cagtgttttgatattcattgctgaaaacaaagttagtataaattcagcattttttgactg

Exon 13 +      78012      78327   2   Terminal    316    61    Marginal
gaaggggaatgagacaaggatgcctactctcttcactcctattcaacgtggtactggaaa
ttctagccagagcgatcaggcaaaagaaagacataaaatgcatccaaataggaaaagaag
aagtcaaattatctccctacaaaaaagtaaaataaaacacctaggaatacatctaactag
AGAAGTGAAAGATCTCTACAAGAAGAACCACAAAACACTGCTGAAAGAAATAATAGATGA
CACAAACAAAGGAAGAACCAATATCATTAAAACGGCCATACTGCCCAAAGCAATCTATAA
ATTCCACACCATTTCTATCAAACTGCAGCTGTCATCTGTTATGGAAGTAGAAAAAAGTAT
TCTAAAATTCATTTGGAACCAAAAAAAAAAAAAAAGAAAGAAAAAAGCCCAAATAGCAAA
AGCAATTCTAAGCAAAAAGAACAAGCCAGAAACATCACATTACCTGACTTCAAGCTATAC
CCTAAGGCTACAGTAA
ccaaaacagtgtggtactggtacaaaaacagacagaacaatgaaacagaatatagaatcc
agaaccaaagctgcctacctacagccatctgatctttgacaacattaccaaaaataagca
atggagaaaggactctcttattcaataaatggtgctgggataatgagtatccataagcag

Exon 14 +      82671      82729   1   Terminal     59    69    Marginal
actttgtagtcctacaattcattttgagattcaaaactgaactagttgttcaaaataaag
tgtcatttaatgctgcagaccaatatctaaaactttagaataataagtcaactccctgaa
aattgtatttgaaaacatgaaagtctctttgtcactggatcaccattccccctttcacag
ATGAGAAGTCTGAAAACAAGATCTTGAGGATTGTTAAAGAAGGGAAAGTAAATGTATGA
tagagaagttaagtgccttttatggactaccattgtttttcaagtgctctcatatatgaa
aggcaggttccctcttgagaaatggaaacatagaaattgagtaacctgctgaggggagga
gaggagcttagattccaacaaaagttttgtctaactcttcaaggtcgctctacttagcag

Exon 15 +      83290      83340   0    Initial     51    53    Marginal
ataaaaaaaattaataaaggagataaatcatgagtgactgggatgttgtttatgcaaagt
ttgtattgtgggagttgtagttgcttattaattttatagaaaatggcaatgccagaggca
ttagagtgacgtatgtctcacatacatggggagagtccttagaaactagcaccaaccaca
ATGCCAGCTGTGAAAATAGGCAGAACTGAAAAGGACTGGTGGTCCATAGCT
gtgagtttcttcctccaggatatgagcagaaaagagctgggaaaatggttggacactaca
ggatgcagaaaaagagatttctctgacttttgcttttctccatgtgacacgatcaactat
attgcagatttagatgagccgaaatataacagtttgtctgatagattaagaaccctcatt

Exon 16 +      88939      89046   0   Internal    108    83        Good
ttggggcctgaactttacatggttatgatttaatgtgatattcctatgctcacatgatgt
ccatagataaataacaagtttaaagtcattaagggttcaggggccgtggagtccttggag
caaattaacataaatgcagcctaattaagacaaatgaatgtgcctgctcttctatttcag
GTGAAACGAATTTCTGAAGATCCTCCTTGCAAATGCCCAAACAAGTTCTGTGTGGAGCGG
CTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGG
gtaaagttttacttttcacttatcttgtttttatgggaagattcagaatttgagttaggg
gaaatatgacagataagagcaggaacttccatatggtgcttacgtttaaagatacatggt
atgaatttttttaaagtaacatacattataatgtactactgaaggctaaatacaactgtt

Exon 17 +      92931      92993   0   Terminal     63    48    Marginal
ttggacagcgatgataaaaccttctgatttctgcagtaacagagatttggattaacagag
atttggattattcccattcaaccataatacgtatctttgaaatgtaaataggtggatctc
aggactaatgtcttgatttcagggaggagagaattttctcttgttcatttgtttattcag
TCAGTTGGTATCTACATAGGCTTCAAGTATCAAGAAGTCACTTGGCAATTGAAATCCGAA
TGA
gcctgtaaaaagggacttcagaaatatgtcttagatgcaataataatgtctgtggtattt
gacttatcaattccaatttgatggctatgttctacctaagtactccaagttggagtgcag
tgctgcggctcactgcaacctccatctcccaggttcaagcgattcttgtgacacagcctc

Exon 18 +      96335      96448   0   Terminal    114    62    Marginal
tgaggggcctaaagaaaagacaatgaataatttaattggaagtcagcaaagggatttgaa
atgttatggcgttacctcctttgtactacttttaaattaaatcatcacagatcaatagaa
aggtcacacacattgttattgactctgtgtaatttcttccttagcataaaaattcttcag
GATTATGCCTGTGTGGTAAAAATCAACTCTCTGAAACAAACCAAGCAAGAGAGGCACCAA
AGCTCTGTTGCTATAGCAACTGAACTTGGCAATGTCTTCTGGGACTTGCTCTAA
ggaaaggtccatgatagtgggtgatattacgttcttttttgctcttatggcacatactga
tttactgtgagtaaaaagtagcatggttcaaatttcatatttttcctagtgatgaaaaat
gggctgttgtgtgaaaatgtaaaggagttttaaacaactagcaaagaagttaaaacctcc

Exon 19 +     130226     130436   2   Terminal    211    50    Marginal
cactctggtatagaccagctacaaatccttcctctgacaccaacattttctatctcattg
ctttcactatgctgactgttctgtaaaatatttattatgactttgtcttctctgtctgaa
atggtgccatacactggtaattagatggagactaagccttcttaatttcatttggtgcag
GGCTGGGAAAATGGAGCCCTTACATAACAACGAGATGAGGACTGACCGGCAGTTGGCGTT
AAGTGCTCCTACACATATTTCCAAGCAGATGCAAATGGAACTTTTCACCAGTCCATCATC
ATATGTCACTTGCTTGCTGCTTTTCCCATGTTTGCTTCCAGAAAGAGGCTACTTGACAGT
CATTTGTCTCTACAATGAGCCTACTTTATGA
agctgaattccctcccccaccagagggaaacaattacagcaggccaggaacttttttctg
ttcagttccaatagtcagaatatttctgacccaaggccctgtccatgttgggagattggt
tctcaacatctagggcactatagtagttcacccttcaaataaagatttgaggattacatc

Exon 20 +     130983     131070   0    Initial     88    78        Good
atcaggattttaataagatttcatttttgaatgtgagctcaagggctaagcacgctggct
gctgctaactttcagcatttttgtatggctaaaacaatgaggctcagattcataaattgt
tccaagcatgtaaagcaccttctttattgtggttttggggttcattcccagttgggcaat
ATGATCATCAGCAAGGACTTCATAAAATGGCAATATGTATCCCTAAAGAAAAGAGGTGTT
GCCTGTGGAAAGACCTTTAAAAACTCAG
gtgactgtacccttggcaaagtcactttaggatgtatagttgagtggtaatgagtattat
ctgaatcctaagagattttcaaatctgaacttcgttgcttcttagctaggtgaccttggg
caattcacttaaccttgtcgagccactgttttctcatttttaaatatgaacataatgcaa

Exon 21 +     133391     133460   0    Initial     70    51    Marginal
agtcatacatgataactctggcatagtaagaaagaatgtgggaaaagaaaatagtagctg
ggctataaagtgctttgcgagccaggttacttgttcttatggagggatgagggtagaagt
aaaagagaaggtatcagaattgctgtcaaattttccacattatgtatgcttctgaccacc
ATGGGGATGCTGATGTCCTCCCCTTACCCCTACTACTTTCCCAGGATCTTCGCCACATTG
CCAATTTACT
gtaagtcatatttctcaggtgagctgtagctaagaatgtctgagaaacactagacaatgg
agagccctcacaggtttttaagaaggcggtagcatgttcagattttcctttgaggaagat
tactgtggctctggagtagacggtggactagtgaagagtgagagatgaggagacatcctg

Exon 22 +     140948     140994   0    Initial     47    47    Marginal
gaaggctttttcaggtgctgcagcctgtaataggagatcagtcccaaatccatctcaact
gactaaaattaggggtttatatagcagagaagaaatataactatgtgtaggaaaacagga
attagggatgggcaaggaggagaagttggttacaagaagcaggtggtcccttaggcaatc
ATGATGGGTGAGGGGTCTGGCTCCCATGGTGCAGATGTGATGATCTG
gtaagtttcagttgcttgacactgtctgggagtcctgatgattgattttctgagaaaaga
actcagataagacagttttaactttctcaaattttaagactgggagggtcaatgtctatg
tttattcaaaagaaatcataaacatcagttctatgggacacttgggcaagtttcaaaagg

Exon 23 +     144891     145109   0   Terminal    219    97   Excellent
cagaaaaaaaacaggacttctttcatagactatatgctaactcagacattttgcaccaag
tagaaaaacaatgggtcatgaaatacaaaccaaaacactaatttcactagaaccaggggt
tgattcaaggtactgtaagaattctcggaatttaacacttttgatattttttcatttcag
ATGCTGCACAACAAACATGTCATGGTCCGTGTGGGAGGAGGCTGGGAAACTTTTGCAGGG
TATTTGTTGAAACACGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACA
TCCCCTATCCAAAGCAAATCTCCAACTCTAAAGGACATGAATCCAGATAACTACTTGGTG
GTCTCTGCCAGTTATAAGGCTAAGAAGGAAATTAAGTGA
aacaaattggtcatgacaaggggaccctcataatggcctgtatccacttctccagtatag
tcagtttagttcatatgttctgaaaactgttttggagaaagatagacagaaaaatgtcat
catattgaaaaatgttcaaagagtagcactatttatttttaatgcttctgtagaatatga

--------------------------------------------------------------------------------