--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (64434 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1462       1579   0    Initial    118    57    Marginal
aacactgctgtggtggagaaactggaccccaggtctggagcgaattccagcctgcagggc
tgataagcgaggcattagtgagattgagagagactttaccccgccgtggtggttggaggg
cgcgcagtagagcagcagcacaggcgcgggtcccgggaggccggctctgctcgcgccgag
ATGTGGAATCTCCTTCACGAAACCGACTCGGCTGTGGCCACCGCGCGCCGCCCGCGCTGG
CTGTGCGCTGGGGCGCTGGTGCTGGCGGGTGGCTTCTTTCTCCTCGGCTTCCTCTTCG
gtaggggggcgcctcgcggagcaaacctcggagtcttccccgtggtgccgcggtgctggg
actcgcgggtcagctgccgagtgggatcctgttgctggtcttccccaggggcggcgatta
gggtcggggtaatgtggggtgagcacccctcgagttaggaggagggtagctgggaacggt

Exon  2 +       3699       3805   1   Terminal    107    82        Good
tttgcatgactctttttcagtgaaagtaggcaagagaaattaaaattcagaaatatctca
cctaatgtcagaggtaatattgataatttgtgttttacaaataatacatacaacaataat
gaaaaataagtcctatctataggctcgtatctcatgcctatttttggatgtatttttcag
GGTGGTTTATAAAATCCTCCAATGAAGCTACTAACATTACTCCAAAGCATAATATGAAAG
CATTTTTGGATGAATTGAAAGCTGAGAACATCAAGAAGTTCTTATAG
taagtacatcctcgaaagtttatatggacaagttgttagaaaaatttatcattctgtttt
ggtccaatattttatatataggaactggacttttttcttaaaattttatttattaaagat
cttggatcacatttcatctgaggaggactatactttcagctaaattttgtcattacagag

Exon  3 +       9430       9616   2   Internal    187    97   Excellent
agagcataaaaatttcaaagcagactttgaaaatctatttcatgcaataatactaccact
ttaattttttaacgtatcacacttcaaagtacttttgtgtaactctgctttactttgttg
atttggaataaaagttgattaaacattaatatctaaccactttcaatttttgttcaccag
TAATTTTACACAGATACCACATTTAGCAGGAACAGAACAAAACTTTCAGCTTGCAAAGCA
AATTCAATCCCAGTGGAAAGAATTTGGCCTGGATTCTGTTGAGCTAGCACATTATGATGT
CCTGTTGTCCTACCCAAATAAGACTCATCCCAACTACATCTCAATAATTAATGAAGATGG
AAATGAG
gtaaaaaataaataaataaataaaagaaacattccccccatttattctttttcaaatacc
ttctatgaaataatgttctatcccatctctaaatattaatagaaatcaatattattggat
cttgtgaatacctttaatatctcattatccgtgtcaactactttcctatgatgtttgagt

Exon  4 +      23102      23227   0   Internal    126    98   Excellent
aattccattctcaatttaaattcatttttcccttgaatctcttctttggagctcatgcat
ttctgaccttcctgtgtgctctgacctcttccctctttcaaaaatgtccaacagtcccca
tgcagaaaaacctccttgttttatatctgactcatattaagtcattcccgatctcaacag
GGCGATCTAGTGTATGTTAACTATGCACGAACTGAAGACTTCTTTAAATTGGAACGGGAC
ATGAAAATCAATTGCTCTGGGAAAATTGTAATTGCCAGATATGGGAAAGTTTTCAGAGGA
AATAAG
gtaaggtaaaaattatctctttttttctctcccccaatgtaaaaagttatagtgggtttt
acatgtgtagaatcattttcttaaaactttatgaataccattattttcttgtattctgtg
acatgcccaccttacagagaggacacatttactaggttatatcccggggttaaattcgag

Exon  5 +      24016      24202   0   Internal    187    67    Marginal
agcttatagtagcaaaaagaaaagggaaattctatccgagatgtcctttgttgtaggcct
aatgagaaaaggttgaagataaagttctggtactcatttaagtgtaatattgaaaattga
tattaccgaatctggaacaaccaatttaaaataaggaaagaaagacactgtgttttctag
GTTAAAAATGCCCAGCTGGCAGGGGCCAAAGGAGTCATTCTCTACTCCGACCCTGCTGAC
TACTTTGCTCCTGGGGTGAAGTCCTATCCAGATGGTTGGAATCTTCCTGGAGGTGGTGTC
CAGCGTGGAAATATCCTAAATCTGAATGGTGCAGGAGACCCTCTCACACCAGGTTACCCA
GCAAATG
gtgaatgatcaatccttgaatatcataggaaacttaacatttgaaagagactttattaaa
gaatttcctttggtacaatggactaagcatgtctttttttattctctttgcatttaagaa
tgaaagaattttgaactctaaagtgattggttcaggccccttacccccttattttgaaac

Exon  6 +      26629      26722   1   Internal     94    61    Marginal
tcacaagcaatgtatgaggatttcagttgctctgcattctcgctaacatttgaattgtta
atctgttttactttaacaattctagcaaatgtgaaattagaatgtatttaatgtgattta
tagagaaccgtttgaatgaaactgagtttttactggaaatatggcaattttttttttcag
AATATGCTTATAGGCGTGGAATTGCAGAGGCTGTTGGTCTTCCAAGTATTCCTGTTCATC
CAATTGGATACTATGATGCACAGAAGCTCCTAGA
gtaagtttgtaagaaaccatggatggctatttgggtaattttcttattgacagttttcaa
atgttaggcttttatctccattttttagtacttaaattttccaacatgggtgttgcttgt
aattttatcagtataaaatagaagagtggttctgttctggaatttagtatatacatgagt

Exon  7 +      32807      32950   0   Terminal    144    75        Good
caaactccttagtgaaaaagggaaaagagagaggaattatttacactttgatagagcatt
ttaaaacgagatgttaattctaatgaattttccacgagaaagtgatcttactgattgttt
ccttattgcatgtgcagtagattctaggttaagttgagctattcatatttcctcaaacag
GTAGACAGGGAACAAGCACCCGTGTACAGGCACAGAAGAAAACAGGACATGACAGAGCAT
GCTGCACCGCACAGCCTGGAGTGCATGAGGGTGCGTGACCGCAGAGAAAGCCTTACAGGA
CAGATTGAAATTCTCCACTTTTGA
tttcataactaaacatctcagtataatatcagataatgacatttatttttccaggccatt
atttaagtggagctgggtttaaggtttggagtattgttaaggaacaaaatgcccgtggta
ggcccaaagaagtctgtttttgccttacagctggattttcataaaaatatagttacaatt

Exon  8 +      34894      35014   2   Internal    121    89        Good
ggctcctgtatacactggtgtgttagtaagtttgtatgccttttctcctgttaatcagtt
ttcagtttattttaccagacttgaaccttcaaaggcagaggggaaaattcccttaaacct
tatagtgttaatctgttaaccagtttttttttttaagaatgtcttttatttttgcattag
AAAAGTCAAGATGCACATCCACTCTACCAATGAAGTGACAAGAATTTACAATGTGATAGG
TACTCTCAGAGGAGCAGTGGAACCAGGTAAAGGAATCGTTTGCTTAGCAAATATTGATCA
A
gtaactgttatgtgctggatactaccaagctctgggagtgcaaagtgaatcaaaacaaac
aaacaaacaaacaaacgaagaaaatcggtggaactcacctaaaaacaaaggaaataagta
tgaaataattttgtattgtggtacaggtggtgaataaaagtgaatgtttggtgctaggct

Exon  9 +      36395      36514   1   Internal    120    92   Excellent
tcagatagaagaaacacatattaaaatcagaaataacatattttcacaaatcttggggaa
cctagccttttttttttttctgaggcgtgagtgctttgtatttagatgctattgagtcat
ttgcaattttctcttttattgacctgaaatgacaaataatcttgtatctatgctttctag
ACAGATATGTCATTCTGGGAGGTCACCGGGACTCATGGGTGTTTGGTGGTATTGACCCTC
AGAGTGGAGCAGCTGTTGTTCATGAAATTGTGAGGAGCTTTGGAACACTGAAAAAGGAAG

gtaatacaaacaaacagcaagaaaaaaaacagcctatctgagtctcagtttagtcttctg
taaagggagtataaaaatactacctcaaccattacatgtgtttggtaaaaatactaatac
aattttcagtgttggttggttaattatattgtttatttatttttgcatttatttatataa

Exon 10 +      37635      37706   0   Terminal     72    67    Marginal
actaccagtcctcaaaaccatgatgtctctatttaaaataaaatgtaaaggcgctcagtt
cttttttctacacagctatcttatatttgaagaaaacaaacaatggagacctaaatttac
ataattcatgaagtaggtagtgtttaattttattacaaaaatgtttcatgatttttctag
GAAATTCCTGTGGTAACTATACAAAACATCACTGTGACAATTACAGAATATGCCAAAGAA
ATGGAATGCTGA
tgaataataataggaaatttgaataatactattgacaaaaacaaaagactcgagttaaca
gctatagtatacacattcttaagcacacatgaatatttactaagatgatgactactcgca
attttgaaagcacctactcagtgctttctaaacattattccatttaatcctcccacaatc

Exon 11 +      40613      40676   0   Internal     64   100   Excellent
agtaatctttattgaaattctttcaaagcagctcttttatgagaatttcttatgtcaaat
ttgtcgttaatatgggtcagctcaattagaaatctacatacattaaatgtagatgtgcat
tttgtgggggagggggagtgggttataactttatatttatagttttcctttttattatag
GAGAATTCAAGACTCCTTCAAGAGCGTGGCGTGGCTTATATTAATGCTGACTCATCTATA
GAAG
gtgaatatcgttggtctcataagaaaagatgtgattaaactaggagcagcagtctagtta
ataaattatgcactaacaaggaaggctatgcattaatgtgtggttagggaatctactgca
acctctgacaggaagcagtgtatgaaccctagttgagagttgggtgagccctaggtgaac

Exon 12 +      48861      49121   0     Single    261    53    Marginal
aaaataacaaagatattcatggcctaaactgagtactggatcaaatggacctgatagata
tctacaaaattctccacccagaaacaacagaatagacattcttctcatcagcccatggca
cttactctaaaattgatcacataattggaagtaaaacactcctcagcaaaagcaaaagaa
ATGAAATTAAAAACGTCTCTTGTACTGCCGTGCAAATTCAAAATCAAGAGTAAGAAATTC
ACTCAAAACTATGCAATTCCATGGAAATTGAATAACCTGCTCCTGAATGACTTGTGGGTA
TATAATGAGATAAAAGCAGGAATCAAGAAGTTCTTTGAAACTAATGAGAACAAAGATATG
ACACACCAGAATCTCTGGGACACAGCTAAGGCAGAATTAAAAGGGAAATTTATAGCACTA
AATGCCCACATTAAAAGTTAG
aaatatctggccaggtgtggtggctcacacctgtaatcccagcactttgggaggccgagg
agggcagatcacaaggtcaggagatcgagaccatcctggcaaacacagtgaaaccccgtc
tctactaaaaatacaaaaaattagccagacgtggtggcgggtgcctgtagtcccagctat

Exon 13 +      50228      50386   0    Initial    159    71        Good
acaggccaatcatgagttctgaaactgaggcagtaataaatagcttaccaaccaaaaaaa
gccaaggaccaaatggattcacagcttaattctaccagaggtacaaagaagggctggtac
tatttctattgaaactattgccaaataattaggaggagagactcctccctaactaattct
ATGAGGCCAGCATCATCCCAATACCAAAATTTGGCAGAGATACAACAGCAACAAAAATTC
AGGCCAGTATCTATGATGAACAATGATGCAAAAATCCTCAATAAAGTACTGGCAAACAGA
ATCCAGCAGCACATTAGAAAGCTTATCCACCACAATCAA
gtaggcttcatcccagggatgcaaggttgattcaacatatgcaaatcaataaatgcagtt
aatcacataggcagaactagaaacaaaaaccacatgattatctcaataaatgcagaaaaa
agctttcaataacattgaatatctcttcatgttaaaaactatcaataaactaggtattga

Exon 14 +      50496      50675   0     Single    180    50    Marginal
caaaaatcctcaataaagtactggcaaacagaatccagcagcacattagaaagcttatcc
accacaatcaagtaggcttcatcccagggatgcaaggttgattcaacatatgcaaatcaa
taaatgcagttaatcacataggcagaactagaaacaaaaaccacatgattatctcaataa
ATGCAGAAAAAAGCTTTCAATAACATTGAATATCTCTTCATGTTAAAAACTATCAATAAA
CTAGGTATTGAAGGAGCAAACCTCAAAATAATAAGAGCCATATATGACAAACCCACAGCC
AACATCGTACTGAATGGGCCAAAGCTACAAGCAGTCCTTTTCAAAACCGACACAAAATAA

ggattcttctctaatcactcctattcaacatagtattggaagtgctggccagggtaatca
ggcaagataaaaaaataaagctcattcaaataaaaagagaggaggtcaaactatccctgt
ttgcagatgacattattctatatctaggaaattccattgtcaaagcccaaaagctcctta

Exon 15 +      51828      51919   0   Internal     92    81        Good
atcacatgagtattttcccacttgtcagaaacttataattcttgatgactgctaatgtat
ggatagcatcccttgtttttgctgaattgtggcttagttactcacttctggttaatggac
atctagtttttaatatatctgatttgtaagtattctctttttttcttttaatttgtgtag
CTGAAAAGCCCTGATGAAGGCTTTGAAGGCAAATCTCTTTATGAAAGTTGGACTAAAAAA
AGTCCTTCCCCAGAGTTCAGTGGCATGCCCAG
gtaaacaaatgaatgaagtttccactgaattcagtgtgggattgttttgaaaataaaagc
acattttctttcaatcattaagtgaaaaattaagtttcaaaatggtctaaaatctgataa
agaaaagcattactttggttcacaaataaaatattactatgtgttttgtagttaaatctg

Exon 16 +      55379      55592   0   Internal    214    92   Excellent
aagcctggaatgtgtttatgtatcataatattagccatttaggatgtagcttattgagat
gcttaagtactttccttgatccatcactgaccaatcttactaatactaatagtaaatatg
gtgctaatcattttttgtaagctatcctataagagatatgttttgttgttttttctgtag
GAAACAAACAAATTCAGCGGCTATCCACTGTATCACAGTGTCTATGAAACATATGAGTTG
GTGGAAAAGTTTTATGATCCAATGTTTAAATATCACCTCACTGTGGCCCAGGTTCGAGGA
GGGATGGTGTTTGAGCTAGCCAATTCCATAGTGCTCCCTTTTGATTGTCGAGATTATGCT
GTAGTTTTAAGAAAGTATGCTGACAAAATCTACA
gtatttctatgaaacatccacaggaaatgaagacatacagtgtatcatttggtatgttac
ccttcctttttcaaattcctcatctgtatggttctattaatctcctaaatataatgggct
atcttaggtcatttattatttattgctatttcaagtgatccaatattctgtttatgtcta

Exon 17 +      55962      56025   1   Internal     64    78        Good
tttccattttatggatgctcacgtcttataatataaaaatataaataccttgtaaaacac
aaaagatgatggcttctatattgttccttttcttgaactatagagcagtgccattagaaa
ttatgttctttaagcatttgatgatcccaatttctatttcagattcacttttttctgcag
TAAAGAATTTTACAGAAATTGCTTCCAAGTTCAGTGAGAGACTCCAGGACTTTGACAAAA
GCAA
gtatgttctacatatatgtgcatatgtgtgtatgtgtgtgtatatatatatatttaaaag
taaactaacatgactgttgctgaactagctttgggaatttcttgctgttttctttttttt
aaatttgttttactttaagttgctggatacatggacagaacgtgcaggtttgttacatag

Exon 18 +      62926      63115   2   Terminal    190    80        Good
attaattactatagatttcatataatagtcttcagagatgattgaacttggaagttcagt
tgacaagtggcttgttcaaattgttataggaatatgcaatccaggaattgcagagtgctc
ttgtgtttctcttgtatatcatttgggcacctaataaacagcaaacgattttatcaacag
GCATGTCATCTATGCTCCAAGCAGCCACAACAAGTATGCAGGGGAGTCATTCCCAGGAAT
TTATGATGCTCTGTTTGATATTGAAAGCAAAGTGGACCCTTCCAAGGCCTGGGGAGAAGT
GAAGAGACAGATTTATGTTGCAGCCTTCACAGTGCAGGCAGCTGCAGAGACTTTGAGTGA
AGTAGCCTAA
gaggattctttagagaatccgtattgaatttgtgtggtatgtcactcagaaagaatcgta
atgggtatattgataaattttaaaattggtatatttgaaataaagttgaatattatatat
agttatgtgagtgtttatatatgtgtgtgtttatattgtttatcttctccctatggatta

--------------------------------------------------------------------------------