--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (42118 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5651       5793   1   Internal    143    69    Marginal
tatgcacaggggcaggtgctctactggtgtcttctataaaacgccaaagcagcccgccag
aaaatggacatttaggcactcgtggtgtctactgagtttgtatggtactgatgagcttgc
ttgactgattatccatgacttactgagtagatcgaacgtatgtggactcacttctcctag
AGGAAGACCCTGTGGCTGCCCCAGCCACTGAGCAGCCTAACCTGGAGACCCTGATGTGCC
CAGAAAGCGTCAACCTTGTATCTGGAGAAACCAGAACTTGCAACAGGGCCAAGCAGGGTG
GCCCATTTAAAGAGGCTCCTAGG
gttttaattgaccttgttttaaaagagacaccctgtaaaatactcctatgaaaacttatt
tcacaagcacctaaccgcattctgtctttggtttgttttacggggccgggccccttgttc
tggtcaattggtctgcattatctctcctcctccaatctcaccacacaccctggcctctgg

Exon  2 +      14647      14761   0   Internal    115    71        Good
gctgtcatcacaaaagtaattatttaaaaggactaattgctcctttggcttcagaggtaa
aaatgcccacatggcagccagttctgtggcagtttggggataatgtggttggatgaataa
gggagctaggaagaaggctgatggtggccttgactctcaatcccctggggctggggacag
GGAATGCAGGTGCAAGCCCTGGTTAAGATCTGCTCCGTGGCCCTGGTGGTTCCCAGTGTA
CCTTCACCCTTGCAGCAGGAGCAAACCATGCTGTCTGGCCTGAGGTCTGATTCAG
gtaaagcataaacaattatggaccagtcgatttcccaaatacaaaattaaaataacttta
ttgagtcatagggggataatttacattatatatgcacgtatgtatttatgcatgcatatg
aatatatatacatatatttgtatataagcttgataaaggtgtaaggcagcagacggcaca

Exon  3 +      15862      16078   2   Terminal    217    66    Marginal
gattctcctgcctcagcctcccaagtagcaaaccttattctttgcagtatttgagcattc
tctgtgctaagggactcagaggaaagagaaacctttagccgttctctatcaggagcttgc
gttttagacatgctgctcttcctggtcttttttttttttttttttgcacctccaaaccag
CTATGGTATGTGGGAGTGCAAAGCCTTTGACAACACAGAGCTTAGGAGCATATGCCTTAC
CACTGTTCTTGGCAGCCTTGGCAATGTGTCTAGTGAGAGGAAGAGGGACAGGAGGGATGG
CTTTCGTCCTTTGGGTAAGAACTGTGCCCAGCCAGAGGGGAACATCATGGCTTCTGCAAG
CAGAGTCCAAGCCCCGCTGTTTATAGTTCAGCCATAA
tggtacgtctacacagcagctctcggaatagggagtggggaggcatgagatctagtccta
ggctccactgtgccagtcagccagaactggagaagactgtacagataagagagctttgaa
gctttgctcgaaatgaacttggctctcaatttcctccttgagagttcaataaaataaaaa

Exon  4 +      19746      19792   0   Internal     47    58    Marginal
tcacatttgttatccacgatctcattccatctcaacagtcctgtgaggctgttggggcaa
gtgtcttcactctacgcctgaaaaactatgcctcagaggagggtaggactcggccaaagc
ccttctgctacactggccctgggcctcatgtgcccaccctgaggacatctttccctgcag
CTCCCTGCCCAGTTGGAAATGCTGACCTTCTTTGCTTACAAGCCCAG
gtgagctcaagcgaactctgactcactaagggttaagccacacaaactcttttatgagtg
gaaaccacttaatgtgccctgtaaaaaagggcccctcaccatgctggctgctttcccttg
gaaagggagtgccagcagggagcagggctatgcacaggccatctttttgcaggaggatgg

Exon  5 +      19893      19971   0    Initial     79    55    Marginal
atgtgcccaccctgaggacatctttccctgcagctccctgcccagttggaaatgctgacc
ttctttgcttacaagcccaggtgagctcaagcgaactctgactcactaagggttaagcca
cacaaactcttttatgagtggaaaccacttaatgtgccctgtaaaaaagggcccctcacc
ATGCTGGCTGCTTTCCCTTGGAAAGGGAGTGCCAGCAGGGAGCAGGGCTATGCACAGGCC
ATCTTTTTGCAGGAGGATG
gtgatggggcagctgccaccctgtagtcttaaaggcatctctgggggttgggagaagttc
tggatgtttccagaaggtcatggtggaaaatgacgtcggccctgaggagaggggcttgtg
ggcatttggccacaggtggagaactggcccatattgttctgcaacatttattaaattctt

Exon  6 +      22755      22870   0   Internal    116    90   Excellent
gaaatttttaattgctgtgagttttgcttttacaaaaaacgctttggcaatgggtggcag
gcaatgggtggaaggacaaattctctttattttcttcctaaatttactctgtgatctgca
ctttccaatgacatttgtccaagaggcactgactgaacaggctgtttgatcccctaacag
ATCATGATTCTGGAAGGAGGTGGTGTAATGAATCTCAACCCCGGCAACAACCTCCTTCAC
CAGCCGCCAGCCTGGACAGACAGCTACTCCACGTGCAATGGTAAGAGGGCCTGTGG
gtgttggtgtcactgctgtgctgtgtgggctctttgctttaattcctctcacaacctaat
gtttgaaaaatataggctttacagcagaagatgtgggacaagaaggaatggagaaaactc
agttttggagttccctaccagcccccagcgttccagacaaaagctcgtttgagatattct

Exon  7 +      22961      23095   0    Initial    135    41    Marginal
aatgaatctcaaccccggcaacaacctccttcaccagccgccagcctggacagacagcta
ctccacgtgcaatggtaagagggcctgtgggtgttggtgtcactgctgtgctgtgtgggc
tctttgctttaattcctctcacaacctaatgtttgaaaaatataggctttacagcagaag
ATGTGGGACAAGAAGGAATGGAGAAAACTCAGTTTTGGAGTTCCCTACCAGCCCCCAGCG
TTCCAGACAAAAGCTCGTTTGAGATATTCTATTGCCTCCTCCCAAAATTCAAGGTTCCAG
ATTGACAGCCTGGCA
gtgaaggggggtagaagagatgcctaaaggaaagactctctgttggagcttttaatagtg
ttttgctgggatatcaagataggctaggagagaaagggtatgtgtgtgtgtgtgtgtgtg
tgtgtgtgtatgtgcgcgtgcatggaggttaggaaggagagggttatagcagttcaatct

Exon  8 +      23411      23560   2   Internal    150    61    Marginal
gcgtgcatggaggttaggaaggagagggttatagcagttcaatctttcttttttcgtctt
ccagtggcctctctttgcaaggggagaggagatttgtaaggagaacaggtgttctcccta
gagctttaatctagaacacgtctattagaagaagaggggacctggtggtggggcgtatag
AGGGTTTGGTGATCAAGCCTGTGGCTTCCTGAATCAAGTTGAATCCCTGAATCAAGTTGA
ATCTCTGAATCAAGTTGTTGCTGAATCGGGAACCCCATACCCCAATTTAGAGCTCTCCAG
TTTAGGCATTCAGCTGTGCATCCAACAGCA
gtgagtttagggagctctgggcctcttctcaatccacacccactgctaatctgcctgcca
gaggctctgctgttcaagtttgctttgaaatatggagatggtttgttggtgaccagagct
tgggaggaggcagaagtgggaggataatgggagagttattctgcagcgagtgctaatcca

Exon  9 +      24059      24116   2   Terminal     58    84        Good
tcaaataccctgtgaggacccagaaagtggattccaaataaaactggaagtctttggcat
ccccaggaccctggcctctcgatgaaggcagcatttctcctgcttgctctggagaaagct
ggggaaatgtgttcagcaggaagtagaactggggtgccacttttatttcttaaattccag
AGACCTCAAAGAAAGCTCAGCCTTGATTGAGACTGAAGAGGAAAAGGAGATCAGTTGA
atggcagagaggatgtgaactcataggaatttttattgtttctcctgaaacttcaggaat
ttggtgggttctctgtctgatgcggaatctccccagtcagcttcagacaaaaatccctga
ttctcccaagtttgaacaagatacactagcagggactatcttttaatctagaccgtatca

Exon 10 +      24606      24671   2   Internal     66    64    Marginal
ggagccacaaaatatatatcccatccttaaacagctttatttgtgaggcaccaaaaattg
ggggaaatggaaagatccagcccaaggtctgtgtatttgggactatttccatataattag
atttttagattagattgttccattcctcccccaacccctgactattggcttcctctttag
AGCCCACGTTGTGGGCCAGGGGCTGCTTTTGTTTCGCCATGAGGTACGAGGAGCTAAGTG
CATACT
gtgagtggtgggtattactaacggcagtcacctctgtgtgctagataaacttgacctcct
gctcttagtgcttctgaggtctggaagccatggatggattctgaatgaatgaggaagaag
agggattgggtcagaaacatttccctttcagtctctcctctgagggtgttgtgggctgga

Exon 11 +      26410      26630   0    Initial    221   100   Excellent
agagagaagaggaagagaacgatttgggtatggacaataagctaataaattgctgaaatg
atagcaatgctctagctttcatgatattttactttgggggaggtgggggatgagctctga
gcacttcagctctcttgtcctcatccagtgtccaggggtaggtagcaggctagggaggac
ATGAAAATGCACTTCTGCTCCATCACCCATGCTGGCACATACACGGACTGTGGTTGTGTC
TCTGAGATATCTGGCAGCCAACAGTACATCCCTGTGTCAGATACTATGGCCAGGAACAGC
CAGGGGTCACTCATGAGGCTGCTTCCTGTTTTGCAGTTTCCAGTGGGTTTTTTGGAGGCC
AGTGGCATGAAATTCATCCTCAGTACTGGACCAAGTACCAG
gtgtgggagtggctccagcacctcctggacaccaaccagctggatgccaattgtatccct
ttccaagagttcgacatcaacggcgagcacctctgcagcatgagtttgcaggagttcacc
cgggcggcagggacggcggggcagctcctctacagcaacttgcagcatctgaagtggaac

Exon 12 +      29096      29208   2   Internal    113    92   Excellent
caaataattgcttctaaggtagtgccttagattcccaattttctggggtcagagactgca
ggcttgagtttgtagaggctgacagagaaaccacctcccataaacaaacataggtgacca
ggcagtaggatggcagaagctctgcaaagatgccagttctgtccttatttaagcatccag
TTCTGGCTCCATCTGGGCCCTCTCTGACTATCCCAATCTGTCCTTCACAGGCCAGTGCAG
TAGTGACCTGTTCCAGTCCACACACAATGTCATTGTCAAGACTGAACAAACTG
gtgagtagtagtggacaaagggagccaacctagcctggcaaagctccggggaggacagtt
gggagagggcaagagagaatgtgggggcaagtttttgcaggaaacacagggaggcctttt
ccctggctgtctctgatgggccacccccaccatgaatctcattcttgcccttgcgaccag

Exon 13 +      31669      31737   1   Internal     69    97   Excellent
aaaggaaaattagacaacattattataaagtaacgcagctgaagcagaatcatatccctt
gtctctgaggaccactcctcaccccccatactttgttgatgaacaatgaattagaaaacg
cagcctcttctccctggggaaaagagatcgctgactattctccttctctattttttgtag
AGCCTTCCATCATGAACACCTGGAAAGACGAGAACTATTTATATGACACCAACTATGGTA
GCACAGTAG
gtaactaactccctgacacttaaggccctttacattcttattcagtttgtctaagagcca
cagtgttctattgtgaggtggggggagggggtgctctaaatgtcctttatcttttcatgg
ccacagatttgttggacagcaaaactttctgccgggctcagatctccatgacaaccacca

Exon 14 +      37035      37097   1   Internal     63    56    Marginal
tgcatcatttttctccatagcatttatcatctctgttttgtttggttcactagcacatac
tcaaaggtgccaggcatgcagtaggtgctcagtaaatattgtttaaatgagtggatgcat
gaataaaaaagagaattataggaaataggtcaattaaacgcctctcatttttctccttag
CAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCACACCAAAAAGC
ACA
gtaagttggctggctttcagatggcctttggtccttcccatcacatcgggcacatctgga
ggccactagttttttggcaaatatcgcctctgtctgctgccttcatgtcttcatcccaaa
cagggtggagtgagaaaatagaggcatcacttgctagcaaagtaagccccctctgcagct

Exon 15 +      38660      38855   1   Internal    196    81        Good
tttattcttaaatacctttttaatgtccaacatctggtgattctgcgatccatcttccct
gacaagtaggggagaaatgagtatctcctacttgcaggaagatgacctaactcaatgctc
tctgccctatctttgctgtgacttagatcattagtaacctgcctttctgcttttcatcag
ACCCGAGAGGGACTCACTTATGGGAATTCATCCGCGACATCCTCTTGAACCCAGACAAGA
ACCCAGGATTAATAAAATGGGAAGACCGATCTGAGGGCGTCTTCAGGTTCTTGAAATCAG
AGGCAGTGGCTCAGCTATGGGGTAAAAAGAAGAACAACAGCAGCATGACCTATGAAAAGC
TCAGCCGAGCTATGAG
gtgaggagtttcatgtctctgaaaacaaaaaggctgtacgacccattatttacctagcaa
ccttcatcggatcagtcaccttatgcaatctcctttgttacagatattactacaaaagag
aaattctggagcgtgtggatggacgaagactggtatataaatttgggaagaatgcccgag

Exon 16 +      38959      39155   1   Terminal    197    57    Marginal
gaggcagtggctcagctatggggtaaaaagaagaacaacagcagcatgacctatgaaaag
ctcagccgagctatgaggtgaggagtttcatgtctctgaaaacaaaaaggctgtacgacc
cattatttacctagcaaccttcatcggatcagtcaccttatgcaatctcctttgttacag
ATATTACTACAAAAGAGAAATTCTGGAGCGTGTGGATGGACGAAGACTGGTATATAAATT
TGGGAAGAATGCCCGAGGATGGAGAGAAAATGAAAACTGAAGCTGCCAATACTTTGGACA
CAAACCAAAACACACACCAAATAATCAGAAACAAAGAACTCCTGGACGTAAATATTTCAA
AGACTACTTTTCTCTGA
tatttatgtaccatgaggggaacaagaaactacttctaacgggaagaagaaacactacgg
tcgattaaaaaaattattttgttacttcgaagtatgtcctatatggggaaaaaacgtaca
cagttttctgtgaaatatgatgctgtatgtggttgtgattttttttcacctctattgtga

--------------------------------------------------------------------------------